rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets

  • Buy Products
  • Performance
  • Primer List

Arraystar supplies pre-designed miRNA-specific PCR primers for the accurate quantification of individual canonical conserved miRNA in qPCR. The primers have been rigorously tested and validated experimentally in numerous sample types.

Benefits

• Reliable results with validated primers
• High sensitivity and specificity
• Accurate quantification over a wide linear range
• Time and cost savings with validated primers and SYBR Green assay

The miRNA-specific PCR Primer Sets perform superbly with the rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor)(CAT# AS-FS-003), rtStar™ PreAMP cDNA Synthesis Kit (CAT# AS-FS-006) and Arraystar SYBR Green qPCR Master Mix. 

Product NameCatalog NoSizePrice
rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets AS-NR-005-1-M 100 reactions
$68.00
Add To Cart

rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets are part of the nrStar™ Canonical Conserved miRNA PCR System, and can be used in combination with rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor) for miRNA detection and quantification. All the primers have been validated in numerous sample types, and guarantee the most accurate and specific performance when used with Arraystar SYBR Green qPCR Master Mix (Figure 1).

miRNA-1

miRNA-2

Figure 1.  Amplification curve and Dissociation curve of example hsa-let-7a-5p.

Pre-designed Human Canonical Conserved miRNA Primer Sets

miRNA ID in miRBase Sequence Catalog Number
hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU AS-NR-005H-1-001
hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU AS-NR-005H-1-002
hsa-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU AS-NR-005H-1-003
hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU AS-NR-005H-1-004
hsa-let-7e-5p UGAGGUAGGAGGUUGUAUAGUU AS-NR-005H-1-005
hsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU AS-NR-005H-1-006
hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU AS-NR-005H-1-007
hsa-let-7i-5p UGAGGUAGUAGUUUGUGCUGUU AS-NR-005H-1-008
hsa-miR-1-3p UGGAAUGUAAAGAAGUAUGUAU AS-NR-005H-1-009
hsa-miR-7-5p UGGAAGACUAGUGAUUUUGUUGUU AS-NR-005H-1-010
hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA AS-NR-005H-1-011
hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG AS-NR-005H-1-012
hsa-miR-10b-5p UACCCUGUAGAACCGAAUUUGUG AS-NR-005H-1-013
hsa-miR-15a-5p UAGCAGCACAUAAUGGUUUGUG AS-NR-005H-1-014
hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA AS-NR-005H-1-015
hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG AS-NR-005H-1-016
hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG AS-NR-005H-1-017
hsa-miR-18a-5p UAAGGUGCAUCUAGUGCAGAUAG AS-NR-005H-1-018
hsa-miR-18b-5p UAAGGUGCAUCUAGUGCAGUUAG AS-NR-005H-1-019
hsa-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA AS-NR-005H-1-020
hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA AS-NR-005H-1-021
hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG AS-NR-005H-1-022
hsa-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG AS-NR-005H-1-023
hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA AS-NR-005H-1-024
hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU AS-NR-005H-1-025
hsa-miR-23a-3p AUCACAUUGCCAGGGAUUUCC AS-NR-005H-1-026
hsa-miR-23b-3p AUCACAUUGCCAGGGAUUACCAC AS-NR-005H-1-027
hsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAG AS-NR-005H-1-028
hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA AS-NR-005H-1-029
hsa-miR-26a-5p UUCAAGUAAUCCAGGAUAGGCU AS-NR-005H-1-030
hsa-miR-26b-5p UUCAAGUAAUUCAGGAUAGGU AS-NR-005H-1-031
hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC AS-NR-005H-1-032
hsa-miR-27b-3p UUCACAGUGGCUAAGUUCUGC AS-NR-005H-1-033
hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA AS-NR-005H-1-034
hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA AS-NR-005H-1-035
hsa-miR-29b-3p UAGCACCAUUUGAAAUCAGUGUU AS-NR-005H-1-036
hsa-miR-29c-3p UAGCACCAUUUGAAAUCGGUUA AS-NR-005H-1-037
hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG AS-NR-005H-1-038
hsa-miR-30b-5p UGUAAACAUCCUACACUCAGCU AS-NR-005H-1-039
hsa-miR-30c-5p UGUAAACAUCCUACACUCUCAGC AS-NR-005H-1-040
hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG AS-NR-005H-1-041
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGAAG AS-NR-005H-1-042
hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU AS-NR-005H-1-043
hsa-miR-32-5p UAUUGCACAUUACUAAGUUGCA AS-NR-005H-1-044
hsa-miR-33a-5p GUGCAUUGUAGUUGCAUUGCA AS-NR-005H-1-045
hsa-miR-33b-5p GUGCAUUGCUGUUGCAUUGC AS-NR-005H-1-046
hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU AS-NR-005H-1-047
hsa-miR-34b-5p UAGGCAGUGUCAUUAGCUGAUUG AS-NR-005H-1-048
hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC AS-NR-005H-1-049
hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU AS-NR-005H-1-050
hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC AS-NR-005H-1-051
hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG AS-NR-005H-1-052
hsa-miR-96-5p UUUGGCACUAGCACAUUUUUGCU AS-NR-005H-1-053
hsa-miR-98-5p UGAGGUAGUAAGUUGUAUUGUU AS-NR-005H-1-054
hsa-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG AS-NR-005H-1-055
hsa-miR-99b-5p CACCCGUAGAACCGACCUUGCG AS-NR-005H-1-056
hsa-miR-100-5p AACCCGUAGAUCCGAACUUGUG AS-NR-005H-1-057
hsa-miR-101-3p UACAGUACUGUGAUAACUGAA AS-NR-005H-1-058
hsa-miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA AS-NR-005H-1-059
hsa-miR-105-5p UCAAAUGCUCAGACUCCUGUGGU AS-NR-005H-1-060
hsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG AS-NR-005H-1-061
hsa-miR-106b-3p CCGCACUGUGGGUACUUGCUGC AS-NR-005H-1-062
hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU AS-NR-005H-1-063
hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA AS-NR-005H-1-064
hsa-miR-122-5p UGGAGUGUGACAAUGGUGUUUG AS-NR-005H-1-065
hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA AS-NR-005H-1-066
hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA AS-NR-005H-1-067
hsa-miR-126-3p UCGUACCGUGAGUAAUAAUGCG AS-NR-005H-1-068
hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG AS-NR-005H-1-069
hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU AS-NR-005H-1-070
hsa-miR-128-3p UCACAGUGAACCGGUCUCUUU AS-NR-005H-1-071
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC AS-NR-005H-1-072
hsa-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU AS-NR-005H-1-073
hsa-miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU AS-NR-005H-1-074
hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG AS-NR-005H-1-075
hsa-miR-133a-3p UUUGGUCCCCUUCAACCAGCUG AS-NR-005H-1-076
hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA AS-NR-005H-1-077
hsa-miR-134-5p UGUGACUGGUUGACCAGAGGGG AS-NR-005H-1-078
hsa-miR-135a-5p UAUGGCUUUUUAUUCCUAUGUGA AS-NR-005H-1-079
hsa-miR-135b-5p UAUGGCUUUUCAUUCCUAUGUGA AS-NR-005H-1-080
hsa-miR-136-3p CAUCAUCGUCUCAAAUGAGUCU AS-NR-005H-1-081
hsa-miR-137-3p UUAUUGCUUAAGAAUACGCGUAG AS-NR-005H-1-082
hsa-miR-138-5p AGCUGGUGUUGUGAAUCAGGCCG AS-NR-005H-1-083
hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAGU AS-NR-005H-1-084
hsa-miR-140-3p UACCACAGGGUAGAACCACGG AS-NR-005H-1-085
hsa-miR-141-3p UAACACUGUCUGGUAAAGAUGG AS-NR-005H-1-086
hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA AS-NR-005H-1-087
hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU AS-NR-005H-1-088
hsa-miR-143-3p UGAGAUGAAGCACUGUAGCUC AS-NR-005H-1-089
hsa-miR-144-5p GGAUAUCAUCAUAUACUGUAAG AS-NR-005H-1-090
hsa-miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU AS-NR-005H-1-091
hsa-miR-146a-5p UGAGAACUGAAUUCCAUGGGUU AS-NR-005H-1-092
hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCUG AS-NR-005H-1-093
hsa-miR-147b-3p GUGUGCGGAAAUGCUUCUGCU AS-NR-005H-1-094
hsa-miR-148a-3p UCAGUGCACUACAGAACUUUGU AS-NR-005H-1-095
hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU AS-NR-005H-1-096
hsa-miR-149-5p UCUGGCUCCGUGUCUUCACUCCC AS-NR-005H-1-097
hsa-miR-150-5p UCUCCCAACCCUUGUACCAGUG AS-NR-005H-1-098
hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG AS-NR-005H-1-099
hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU AS-NR-005H-1-100
hsa-miR-152-3p UCAGUGCAUGACAGAACUUGG AS-NR-005H-1-101
hsa-miR-153-3p UUGCAUAGUCACAAAAGUGAUC AS-NR-005H-1-102
hsa-miR-154-5p UAGGUUAUCCGUGUUGCCUUCG AS-NR-005H-1-103
hsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGUU AS-NR-005H-1-104
hsa-miR-154-3p AAUCAUACACGGUUGACCUAUU AS-NR-005H-1-105
hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU AS-NR-005H-1-106
hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU AS-NR-005H-1-107
hsa-miR-181c-5p AACAUUCAACCUGUCGGUGAGU AS-NR-005H-1-108
hsa-miR-181d-5p AACAUUCAUUGUUGUCGGUGGGU AS-NR-005H-1-109
hsa-miR-182-5p UUUGGCAAUGGUAGAACUCACACU AS-NR-005H-1-110
hsa-miR-183-5p UAUGGCACUGGUAGAAUUCACU AS-NR-005H-1-111
hsa-miR-184 UGGACGGAGAACUGAUAAGGGU AS-NR-005H-1-112
hsa-miR-185-5p UGGAGAGAAAGGCAGUUCCUGA AS-NR-005H-1-113
hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU AS-NR-005H-1-114
hsa-miR-187-3p UCGUGUCUUGUGUUGCAGCCGG AS-NR-005H-1-115
hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG AS-NR-005H-1-116
hsa-miR-190a-5p UGAUAUGUUUGAUAUAUUAGGU AS-NR-005H-1-117
hsa-miR-191-5p CAACGGAAUCCCAAAAGCAGCUG AS-NR-005H-1-118
hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC AS-NR-005H-1-119
hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA AS-NR-005H-1-120
hsa-miR-193b-3p AACUGGCCCUCAAAGUCCCGCU AS-NR-005H-1-121
hsa-miR-193b-5p CGGGGUUUUGAGGGCGAGAUGA AS-NR-005H-1-122
hsa-miR-194-5p UGUAACAGCAACUCCAUGUGGA AS-NR-005H-1-123
hsa-miR-195-5p UAGCAGCACAGAAAUAUUGGC AS-NR-005H-1-124
hsa-miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG AS-NR-005H-1-125
hsa-miR-196b-5p UAGGUAGUUUCCUGUUGUUGGG AS-NR-005H-1-126
hsa-miR-197-3p UUCACCACCUUCUCCACCCAGC AS-NR-005H-1-127
hsa-miR-199a-3p;
hsa-miR-199b-3p
ACAGUAGUCUGCACAUUGGUUA AS-NR-005H-1-128
hsa-miR-200a-3p UAACACUGUCUGGUAACGAUGU AS-NR-005H-1-129
hsa-miR-200b-3p UAAUACUGCCUGGUAAUGAUGA AS-NR-005H-1-130
hsa-miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA AS-NR-005H-1-131
hsa-miR-202-3p AGAGGUAUAGGGCAUGGGAA AS-NR-005H-1-132
hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG AS-NR-005H-1-133
hsa-miR-203a-3p GUGAAAUGUUUAGGACCACUAG AS-NR-005H-1-134
hsa-miR-204-5p UUCCCUUUGUCAUCCUAUGCCU AS-NR-005H-1-135
hsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUG AS-NR-005H-1-136
hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG AS-NR-005H-1-137
hsa-miR-208a-3p AUAAGACGAGCAAAAAGCUUGU AS-NR-005H-1-138
hsa-miR-208b-3p AUAAGACGAACAAAAGGUUUGU AS-NR-005H-1-139
hsa-miR-210-3p CUGUGCGUGUGACAGCGGCUGA AS-NR-005H-1-140
hsa-miR-211-5p UUCCCUUUGUCAUCCUUCGCCU AS-NR-005H-1-141
hsa-miR-212-5p ACCUUGGCUCUAGACUGCUUACU AS-NR-005H-1-142
hsa-miR-214-3p ACAGCAGGCACAGACAGGCAGU AS-NR-005H-1-143
hsa-miR-215-5p AUGACCUAUGAAUUGACAGAC AS-NR-005H-1-144
hsa-miR-216b-5p AAAUCUCUGCAGGCAAAUGUGA AS-NR-005H-1-145
hsa-miR-217-5p UACUGCAUCAGGAACUGAUUGGA AS-NR-005H-1-146
hsa-miR-218-5p UUGUGCUUGAUCUAACCAUGU AS-NR-005H-1-147
hsa-miR-219a-2-3p AGAAUUGUGGCUGGACAUCUGU AS-NR-005H-1-148
hsa-miR-219a-5p UGAUUGUCCAAACGCAAUUCU AS-NR-005H-1-149
hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC AS-NR-005H-1-150
hsa-miR-222-3p AGCUACAUCUGGCUACUGGGU AS-NR-005H-1-151
hsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCA AS-NR-005H-1-152
hsa-miR-224-5p UCAAGUCACUAGUGGUUCCGUUUAG AS-NR-005H-1-153
hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU AS-NR-005H-1-154
hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU AS-NR-005H-1-155
hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU AS-NR-005H-1-156
hsa-miR-301a-3p CAGUGCAAUAGUAUUGUCAAAGC AS-NR-005H-1-157
hsa-miR-301b-3p CAGUGCAAUGAUAUUGUCAAAGC AS-NR-005H-1-158
hsa-miR-302a-3p UAAGUGCUUCCAUGUUUUGGUGA AS-NR-005H-1-159
hsa-miR-302b-3p UAAGUGCUUCCAUGUUUUAGUAG AS-NR-005H-1-160
hsa-miR-302c-3p UAAGUGCUUCCAUGUUUCAGUGG AS-NR-005H-1-161
hsa-miR-302d-3p UAAGUGCUUCCAUGUUUGAGUGU AS-NR-005H-1-162
hsa-miR-323a-3p CACAUUACACGGUCGACCUCU AS-NR-005H-1-163
hsa-miR-323b-3p CCCAAUACACGGUCGACCUCUU AS-NR-005H-1-164
hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUG AS-NR-005H-1-165
hsa-miR-326 CCUCUGGGCCCUUCCUCCAG AS-NR-005H-1-166
hsa-miR-329-3p AACACACCUGGUUAACCUCUUU AS-NR-005H-1-167
hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA AS-NR-005H-1-168
hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA AS-NR-005H-1-169
hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU AS-NR-005H-1-170
hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC AS-NR-005H-1-171
hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG AS-NR-005H-1-172
hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG AS-NR-005H-1-173
hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG AS-NR-005H-1-174
hsa-miR-340-5p UUAUAAAGCAAUGAGACUGAUU AS-NR-005H-1-175
hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU AS-NR-005H-1-176
hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC AS-NR-005H-1-177
hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU AS-NR-005H-1-178
hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU AS-NR-005H-1-179
hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC AS-NR-005H-1-180
hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU AS-NR-005H-1-181
hsa-miR-363-3p AAUUGCACGGUAUCCAUCUGUA AS-NR-005H-1-182
hsa-miR-365a-3p UAAUGCCCCUAAAAAUCCUUAU AS-NR-005H-1-183
hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU AS-NR-005H-1-184
hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC AS-NR-005H-1-185
hsa-miR-370-3p GCCUGCUGGGGUGGAACCUGGU AS-NR-005H-1-186
hsa-miR-371a-5p ACUCAAACUGUGGGGGCACU AS-NR-005H-1-187
hsa-miR-372-3p AAAGUGCUGCGACAUUUGAGCGU AS-NR-005H-1-188
hsa-miR-373-3p GAAGUGCUUCGAUUUUGGGGUGU AS-NR-005H-1-189
hsa-miR-374a-3p CUUAUCAGAUUGUAUUGUAAUU AS-NR-005H-1-190
hsa-miR-374a-5p UUAUAAUACAACCUGAUAAGUG AS-NR-005H-1-191
hsa-miR-374b-5p AUAUAAUACAACCUGCUAAGUG AS-NR-005H-1-192
hsa-miR-375-3p UUUGUUCGUUCGGCUCGCGUGA AS-NR-005H-1-193
hsa-miR-376a-3p AUCAUAGAGGAAAAUCCACGU AS-NR-005H-1-194
hsa-miR-376b-3p AUCAUAGAGGAAAAUCCAUGUU AS-NR-005H-1-195
hsa-miR-376c-3p AACAUAGAGGAAAUUCCACGU AS-NR-005H-1-196
hsa-miR-377-3p AUCACACAAAGGCAACUUUUGU AS-NR-005H-1-197
hsa-miR-377-5p AGAGGUUGCCCUUGGUGAAUUC AS-NR-005H-1-198
hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGGC AS-NR-005H-1-199
hsa-miR-379-5p UGGUAGACUAUGGAACGUAGG AS-NR-005H-1-200
hsa-miR-380-3p UAUGUAAUAUGGUCCACAUCUU AS-NR-005H-1-201
hsa-miR-380-5p UGGUUGACCAUAGAACAUGCGC AS-NR-005H-1-202
hsa-miR-381-3p UAUACAAGGGCAAGCUCUCUGU AS-NR-005H-1-203
hsa-miR-382-3p AAUCAUUCACGGACAACACUU AS-NR-005H-1-204
hsa-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG AS-NR-005H-1-205
hsa-miR-383-5p AGAUCAGAAGGUGAUUGUGGCU AS-NR-005H-1-206
hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU AS-NR-005H-1-207
hsa-miR-410-3p AAUAUAACACAGAUGGCCUGU AS-NR-005H-1-208
hsa-miR-411-5p UAGUAGACCGUAUAGCGUACG AS-NR-005H-1-209
hsa-miR-412-5p UGGUCGACCAGUUGGAAAGUAAU AS-NR-005H-1-210
hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC AS-NR-005H-1-211
hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU AS-NR-005H-1-212
hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU AS-NR-005H-1-213
hsa-miR-424-5p CAGCAGCAAUUCAUGUUUUGAA AS-NR-005H-1-214
hsa-miR-425-5p AAUGACACGAUCACUCCCGUUGA AS-NR-005H-1-215
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU AS-NR-005H-1-216
hsa-miR-431-5p UGUCUUGCAGGCCGUCAUGCA AS-NR-005H-1-217
hsa-miR-432-5p UCUUGGAGUAGGUCAUUGGGUGG AS-NR-005H-1-218
hsa-miR-433-3p AUCAUGAUGGGCUCCUCGGUGU AS-NR-005H-1-219
hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU AS-NR-005H-1-220
hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU AS-NR-005H-1-221
hsa-miR-449b-5p AGGCAGUGUAUUGUUAGCUGGC AS-NR-005H-1-222
hsa-miR-449c-5p UAGGCAGUGUAUUGCUAGCGGCUGU AS-NR-005H-1-223
hsa-miR-450a-5p UUUUGCGAUGUGUUCCUAAUAU AS-NR-005H-1-224
hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA AS-NR-005H-1-225
hsa-miR-451a AAACCGUUACCAUUACUGAGUU AS-NR-005H-1-226
hsa-miR-452-5p AACUGUUUGCAGAGGAAACUGA AS-NR-005H-1-227
hsa-miR-454-3p UAGUGCAAUAUUGCUUAUAGGGU AS-NR-005H-1-228
hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC AS-NR-005H-1-229
hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG AS-NR-005H-1-230
hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG AS-NR-005H-1-231
hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC AS-NR-005H-1-232
hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG AS-NR-005H-1-233
hsa-miR-487a-5p GUGGUUAUCCCUGCUGUGUUCG AS-NR-005H-1-234
hsa-miR-487b-3p AAUCGUACAGGGUCAUCCACUU AS-NR-005H-1-235
hsa-miR-488-3p UUGAAAGGCUAUUUCUUGGUC AS-NR-005H-1-236
hsa-miR-488-5p CCCAGAUAAUGGCACUCUCAA AS-NR-005H-1-237
hsa-miR-489-3p GUGACAUCACAUAUACGGCAGC AS-NR-005H-1-238
hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG AS-NR-005H-1-239
hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG AS-NR-005H-1-240
hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU AS-NR-005H-1-241
hsa-miR-494-3p UGAAACAUACACGGGAAACCUC AS-NR-005H-1-242
hsa-miR-495-3p AAACAAACAUGGUGCACUUCUU AS-NR-005H-1-243
hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC AS-NR-005H-1-244
hsa-miR-497-5p CAGCAGCACACUGUGGUUUGU AS-NR-005H-1-245
hsa-miR-498-5p UUUCAAGCCAGGGGGCGUUUUUC AS-NR-005H-1-246
hsa-miR-499a-5p UUAAGACUUGCAGUGAUGUUU AS-NR-005H-1-247
hsa-miR-500a-3p AUGCACCUGGGCAAGGAUUCUG AS-NR-005H-1-248
hsa-miR-500b-5p AAUCCUUGCUACCUGGGU AS-NR-005H-1-249
hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU AS-NR-005H-1-250
hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA AS-NR-005H-1-251
hsa-miR-503-5p UAGCAGCGGGAACAGUUCUGCAG AS-NR-005H-1-252
hsa-miR-504-5p AGACCCUGGUCUGCACUCUAUC AS-NR-005H-1-253
hsa-miR-506-3p UAAGGCACCCUUCUGAGUAGA AS-NR-005H-1-254
hsa-miR-506-5p UAUUCAGGAAGGUGUUACUUAA AS-NR-005H-1-255
hsa-miR-507 UUUUGCACCUUUUGGAGUGAA AS-NR-005H-1-256
hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA AS-NR-005H-1-257
hsa-miR-510-5p UACUCAGGAGAGUGGCAAUCAC AS-NR-005H-1-258
hsa-miR-511-3p AAUGUGUAGCAAAAGACAGA AS-NR-005H-1-259
hsa-miR-511-5p GUGUCUUUUGCUCUGCAGUCA AS-NR-005H-1-260
hsa-miR-513b-5p UUCACAAGGAGGUGUCAUUUAU AS-NR-005H-1-261
hsa-miR-514a-3p AUUGACACUUCUGUGAGUAGA AS-NR-005H-1-262
hsa-miR-514b-5p UUCUCAAGAGGGAGGCAAUCAU AS-NR-005H-1-263
hsa-miR-516b-5p AUCUGGAGGUAAGAAGCACUUU AS-NR-005H-1-264
hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU AS-NR-005H-1-265
hsa-miR-518c-3p CAAAGCGCUUCUCUUUAGAGUGU AS-NR-005H-1-266
hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG AS-NR-005H-1-267
hsa-miR-518f-3p GAAAGCGCUUCUCUUUAGAGG AS-NR-005H-1-268
hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU AS-NR-005H-1-269
hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU AS-NR-005H-1-270
hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU AS-NR-005H-1-271
hsa-miR-522-3p AAAAUGGUUCCCUUUAGAGUGU AS-NR-005H-1-272
hsa-miR-523-3p GAACGCGCUUCCCUAUAGAGGGU AS-NR-005H-1-273
hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU AS-NR-005H-1-274
hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC AS-NR-005H-1-275
hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG AS-NR-005H-1-276
hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU AS-NR-005H-1-277
hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU AS-NR-005H-1-278
hsa-miR-539-3p AUCAUACAAGGACAAUUUCUUU AS-NR-005H-1-279
hsa-miR-541-5p AAAGGAUUCUGCUGUCGGUCCCACU AS-NR-005H-1-280
hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA AS-NR-005H-1-281
hsa-miR-543 AAACAUUCGCGGUGCACUUCUU AS-NR-005H-1-282
hsa-miR-545-5p UCAGUAAAUGUUUAUUAGAUGA AS-NR-005H-1-283
hsa-miR-551a GCGACCCACUCUUGGUUUCCA AS-NR-005H-1-284
hsa-miR-551b-3p GCGACCCAUACUUGGUUUCAG AS-NR-005H-1-285
hsa-miR-574-3p CACGCUCAUGCACACACCCACA AS-NR-005H-1-286
hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU AS-NR-005H-1-287
hsa-miR-577 UAGAUAAAAUAUUGGUACCUG AS-NR-005H-1-288
hsa-miR-579-5p UCGCGGUUUGUGCCAGAUGACG AS-NR-005H-1-289
hsa-miR-582-3p UAACUGGUUGAACAACUGAACC AS-NR-005H-1-290
hsa-miR-584-5p UUAUGGUUUGCCUGGGACUGAG AS-NR-005H-1-291
hsa-miR-589-5p UGAGAACCACGUCUGCUCUGAG AS-NR-005H-1-292
hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU AS-NR-005H-1-293
hsa-miR-597-3p UGGUUCUCUUGUGGCUCAAGCGU AS-NR-005H-1-294
hsa-miR-598-3p UACGUCAUCGUUGUCAUCGUCA AS-NR-005H-1-295
hsa-miR-605-3p AGAAGGCACUAUGAGAUUUAGA AS-NR-005H-1-296
hsa-miR-624-5p UAGUACCAGUACCUUGUGUUCA AS-NR-005H-1-297
hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG AS-NR-005H-1-298
hsa-miR-651-5p UUUAGGAUAAGCUUGACUUUUG AS-NR-005H-1-299
hsa-miR-652-3p AAUGGCGCCACUAGGGUUGUG AS-NR-005H-1-300
hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU AS-NR-005H-1-301
hsa-miR-656-3p AAUAUUAUACAGUCAACCUCU AS-NR-005H-1-302
hsa-miR-660-5p UACCCAUUGCAUAUCGGAGUUG AS-NR-005H-1-303
hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC AS-NR-005H-1-304
hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG AS-NR-005H-1-305
hsa-miR-675-3p CUGUAUGCCCUCACCGCUCA AS-NR-005H-1-306
hsa-miR-676-3p CUGUCCUAAGGUUGUUGAGUU AS-NR-005H-1-307
hsa-miR-708-5p AAGGAGCUUACAAUCUAGCUGGG AS-NR-005H-1-308
hsa-miR-744-5p UGCGGGGCUAGGGCUAACAGCA AS-NR-005H-1-309
hsa-miR-758-3p UUUGUGACCUGGUCCACUAACC AS-NR-005H-1-310
hsa-miR-760 CGGCUCUGGGUCUGUGGGGA AS-NR-005H-1-311
hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU AS-NR-005H-1-312
hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA AS-NR-005H-1-313
hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU AS-NR-005H-1-314
hsa-miR-873-3p GGAGACUGAUGAGUUCCCGGGA AS-NR-005H-1-315
hsa-miR-873-5p GCAGGAACUUGUGAGUCUCCU AS-NR-005H-1-316
hsa-miR-874-3p CUGCCCUGGCCCGAGGGACCGA AS-NR-005H-1-317
hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG AS-NR-005H-1-318
hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA AS-NR-005H-1-319
hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU AS-NR-005H-1-320
hsa-miR-887-3p GUGAACGGGCGCCAUCCCGAGG AS-NR-005H-1-321
hsa-miR-887-5p CUUGGGAGCCCUGUUAGACUC AS-NR-005H-1-322
hsa-miR-888-5p UACUCAAAAAGCUGUCAGUCA AS-NR-005H-1-323
hsa-miR-889-3p UUAAUAUCGGACAACCAUUGU AS-NR-005H-1-324
hsa-miR-890 UACUUGGAAAGGCAUCAGUUG AS-NR-005H-1-325
hsa-miR-892a CACUGUGUCCUUUCUGCGUAG AS-NR-005H-1-326
hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA AS-NR-005H-1-327
hsa-miR-892c-3p CACUGUUUCCUUUCUGAGUGGA AS-NR-005H-1-328
hsa-miR-934 UGUCUACUACUGGAGACACUGG AS-NR-005H-1-329
hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC AS-NR-005H-1-330
hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG AS-NR-005H-1-331
hsa-miR-1180-3p UUUCCGGCUCGCGUGGGUGUGU AS-NR-005H-1-332
hsa-miR-1185-1-3p AUAUACAGGGGGAGACUCUUAU AS-NR-005H-1-333
hsa-miR-1185-2-3p AUAUACAGGGGGAGACUCUCAU AS-NR-005H-1-334
hsa-miR-1185-5p AGAGGAUACCCUUUGUAUGUU AS-NR-005H-1-335
hsa-miR-1197 UAGGACACAUGGUCUACUUCU AS-NR-005H-1-336
hsa-miR-1247-5p ACCCGUCCCGUUCGUCCCCGGA AS-NR-005H-1-337
hsa-miR-1249-3p ACGCCCUUCCCCCCCUUCUUCA AS-NR-005H-1-338
hsa-miR-1251-5p ACUCUAGCUGCCAAAGGCGCU AS-NR-005H-1-339
hsa-miR-1264 CAAGUCUUAUUUGAGCACCUGUU AS-NR-005H-1-340
hsa-miR-1271-5p CUUGGCACCUAGCAAGCACUCA AS-NR-005H-1-341
hsa-miR-1277-5p AAAUAUAUAUAUAUAUGUACGUAU AS-NR-005H-1-342
hsa-miR-1283 UCUACAAAGGAAAGCGCUUUCU AS-NR-005H-1-343
hsa-miR-1298-5p UUCAUUCGGCUGUCCAGAUGUA AS-NR-005H-1-344
hsa-miR-1301-3p UUGCAGCUGCCUGGGAGUGACUUC AS-NR-005H-1-345
hsa-miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG AS-NR-005H-1-346
hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU AS-NR-005H-1-347
hsa-miR-1323 UCAAAACUGAGGGGCAUUUUCU AS-NR-005H-1-348
hsa-miR-1343-3p CUCCUGGGGCCCGCACUCUCGC AS-NR-005H-1-349
hsa-miR-1911-5p UGAGUACCGCCAUGUCUGUUGGG AS-NR-005H-1-350
hsa-miR-1912-3p UACCCAGAGCAUGCAGUGUGAA AS-NR-005H-1-351
hsa-miR-2114-3p CGAGCCUCAAGCAAGGGACUU AS-NR-005H-1-352
hsa-miR-2114-5p UAGUCCCUUCCUUGAAGCGGUC AS-NR-005H-1-353
hsa-miR-2355-3p AUUGUCCUUGCUGUUUGGAGAU AS-NR-005H-1-354
hsa-miR-2681-5p GUUUUACCACCUCCAGGAGACU AS-NR-005H-1-355
hsa-miR-2681-3p UAUCAUGGAGUUGGUAAAGCAC AS-NR-005H-1-356
hsa-miR-3059-5p UUUCCUCUCUGCCCCAUAGGGUGU AS-NR-005H-1-357
hsa-miR-3085-3p UCUGGCUGCUAUGGCCCCCUC AS-NR-005H-1-358
hsa-miR-3140-3p AGCUUUUGGGAAUUCAGGUAGU AS-NR-005H-1-359
hsa-miR-3145-3p AGAUAUUUUGAGUGUUUGGAAUUG AS-NR-005H-1-360
hsa-miR-3146 CAUGCUAGGAUAGAAAGAAUGG AS-NR-005H-1-361
hsa-miR-3173-5p UGCCCUGCCUGUUUUCUCCUUU AS-NR-005H-1-362
hsa-miR-3200-3p CACCUUGCGCUACUCAGGUCUG AS-NR-005H-1-363
hsa-miR-3613-5p UGUUGUACUUUUUUUUUUGUUC AS-NR-005H-1-364
hsa-miR-3617-5p AAAGACAUAGUUGCAAGAUGGG AS-NR-005H-1-365
hsa-miR-3934-5p UCAGGUGUGGAAACUGAGGCAG AS-NR-005H-1-366
hsa-miR-4524a-3p UGAGACAGGCUUAUGCUGCUAU AS-NR-005H-1-367
hsa-miR-4677-3p UCUGUGAGACCAAAGAACUACU AS-NR-005H-1-368
hsa-miR-4766-3p AUAGCAAUUGCUCUUUUGGAA AS-NR-005H-1-369
hsa-miR-4766-5p UCUGAAAGAGCAGUUGGUGUU AS-NR-005H-1-370
hsa-miR-6529-5p GAGAGAUCAGAGGCGCAGAGUG AS-NR-005H-1-371
hsa-miR-9851-3p UGGCACCAGCACUGGCGGUGUC AS-NR-005H-1-372
RNU6 Reference gene AS-NR-005H-1-373
SNORD43 Reference gene AS-NR-005H-1-374
SNORD95 Reference gene AS-NR-005H-1-375