rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets

  • Buy Products
  • Performance
  • Primer List

Arraystar supplies pre-designed miRNA-specific PCR primers for the accurate quantification of individual canonical conserved miRNA in qPCR. The primers have been rigorously tested and validated experimentally in numerous sample types.


• Reliable results with validated primers
• High sensitivity and specificity
• Accurate quantification over a wide linear range
• Time and cost savings with validated primers and SYBR Green assay

The miRNA-specific PCR Primer Sets perform superbly with the rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor)(CAT# AS-FS-003), rtStar™ PreAMP cDNA Synthesis Kit (CAT# AS-FS-006) and Arraystar SYBR Green qPCR Master Mix. 

Product NameCatalog NoSizePrice
rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets AS-NR-005-1-M 100 reactions $68.00
Add To Cart

rtStar™ Pre-designed Canonical Conserved miRNA Primer Sets are part of the nrStar™ Canonical Conserved miRNA PCR System, and can be used in combination with rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor) for miRNA detection and quantification. All the primers have been validated in numerous sample types, and guarantee the most accurate and specific performance when used with Arraystar SYBR Green qPCR Master Mix (Figure 1).



Figure 1.  Amplification curve and Dissociation curve of example hsa-let-7a-5p.

Pre-designed Human Canonical Conserved miRNA Primer Sets

miRNA ID in miRBase Sequence Catalog Number
hsa-miR-33b-5p GUGCAUUGCUGUUGCAUUGC AS-NR-005H-1-046
hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU AS-NR-005H-1-063
hsa-miR-147b-3p GUGUGCGGAAAUGCUUCUGCU AS-NR-005H-1-094
hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG AS-NR-005H-1-099
hsa-miR-151a-5p UCGAGGAGCUCACAGUCUAGU AS-NR-005H-1-100
hsa-miR-202-3p AGAGGUAUAGGGCAUGGGAA AS-NR-005H-1-132
hsa-miR-219a-2-3p AGAAUUGUGGCUGGACAUCUGU AS-NR-005H-1-148
hsa-miR-219a-5p UGAUUGUCCAAACGCAAUUCU AS-NR-005H-1-149
hsa-miR-323a-3p CACAUUACACGGUCGACCUCU AS-NR-005H-1-163
hsa-miR-371a-5p ACUCAAACUGUGGGGGCACU AS-NR-005H-1-187
hsa-miR-376a-3p AUCAUAGAGGAAAAUCCACGU AS-NR-005H-1-194
hsa-miR-376c-3p AACAUAGAGGAAAUUCCACGU AS-NR-005H-1-196
hsa-miR-499a-5p UUAAGACUUGCAGUGAUGUUU AS-NR-005H-1-247
hsa-miR-500b-5p AAUCCUUGCUACCUGGGU AS-NR-005H-1-249
hsa-miR-511-3p AAUGUGUAGCAAAAGACAGA AS-NR-005H-1-259
hsa-miR-514a-3p AUUGACACUUCUGUGAGUAGA AS-NR-005H-1-262
hsa-miR-518f-3p GAAAGCGCUUCUCUUUAGAGG AS-NR-005H-1-268
hsa-miR-551b-3p GCGACCCAUACUUGGUUUCAG AS-NR-005H-1-285
hsa-miR-675-3p CUGUAUGCCCUCACCGCUCA AS-NR-005H-1-306
hsa-miR-1185-1-3p AUAUACAGGGGGAGACUCUUAU AS-NR-005H-1-333
hsa-miR-1185-2-3p AUAUACAGGGGGAGACUCUCAU AS-NR-005H-1-334
hsa-miR-1185-5p AGAGGAUACCCUUUGUAUGUU AS-NR-005H-1-335
hsa-miR-1251-5p ACUCUAGCUGCCAAAGGCGCU AS-NR-005H-1-339
hsa-miR-1307-5p UCGACCGGACCUCGACCGGCU AS-NR-005H-1-347
hsa-miR-2114-3p CGAGCCUCAAGCAAGGGACUU AS-NR-005H-1-352
hsa-miR-3085-3p UCUGGCUGCUAUGGCCCCCUC AS-NR-005H-1-358
hsa-miR-4524a-3p UGAGACAGGCUUAUGCUGCUAU AS-NR-005H-1-367
hsa-miR-4766-3p AUAGCAAUUGCUCUUUUGGAA AS-NR-005H-1-369
hsa-miR-4766-5p UCUGAAAGAGCAGUUGGUGUU AS-NR-005H-1-370
RNU6 Reference gene AS-NR-005H-1-373
SNORD43 Reference gene AS-NR-005H-1-374
SNORD95 Reference gene AS-NR-005H-1-375