• Description
  • Highlights
  • Primer List
  • Manuals
Product NameCatalog NoSizePrice
miRStar™ Pre-designed miRNA-specific Forward Primers AS-MR-007 1 OD

miRStar™ Pre-designed miRNA-specific Forward Primers are part of the miRStar™ miRNA PCR System, and can be used in combination with miRStar™ miRNA First-Strand cDNA Synthesis Kit for mature miRNA detection and quantification. They cover 278 human mature miRNAs characterized in the latest miRBase version. All the primers have been validated in serum samples, and guarantee the most accurate and specific performance when used with miRStar™ SYBR® Green qPCR Master Mix (Figure 1).


Fig1.  Amplification curve (A) and Dissociation curve (B) of example miRNA has-miR-142-3p

Reliable results with validated primers

High sensitivity and specificity

Accurate quantification over a wide linear range

Time and cost savings with validated primers and SYBR Green assay

miRname Accession microRNA Target Sequence Catalog Number
hsa-let-7a-5p MIMAT0000062 UGAGGUAGUAGGUUGUAUAGUU A12P-miR-001
hsa-let-7b-5p MIMAT0000063 UGAGGUAGUAGGUUGUGUGGUU A12P-miR-002
hsa-let-7b-3p MIMAT0004482 CUAUACAACCUACUGCCUUCCC A12P-miR-003
hsa-let-7c MIMAT0000064 UGAGGUAGUAGGUUGUAUGGUU A12P-miR-004
hsa-let-7d-5p MIMAT0000065 AGAGGUAGUAGGUUGCAUAGUU A12P-miR-005
hsa-let-7d-3p MIMAT0004484 CUAUACGACCUGCUGCCUUUCU A12P-miR-006
hsa-let-7e-5p MIMAT0000066 UGAGGUAGGAGGUUGUAUAGUU A12P-miR-007
hsa-let-7f-5p MIMAT0000067 UGAGGUAGUAGAUUGUAUAGUU A12P-miR-008
hsa-let-7g-5p MIMAT0000414 UGAGGUAGUAGUUUGUACAGUU A12P-miR-009
hsa-let-7i-5p MIMAT0000415 UGAGGUAGUAGUUUGUGCUGUU A12P-miR-010
hsa-let-7i-3p MIMAT0004585 CUGCGCAAGCUACUGCCUUGCU A12P-miR-011
hsa-miR-1 MIMAT0000416 UGGAAUGUAAAGAAGUAUGUAU A12P-miR-012
hsa-miR-100-5p MIMAT0000098 AACCCGUAGAUCCGAACUUGUG A12P-miR-013
hsa-miR-101-3p MIMAT0000099 UACAGUACUGUGAUAACUGAA A12P-miR-014
hsa-miR-103a-3p MIMAT0000101 AGCAGCAUUGUACAGGGCUAUGA A12P-miR-015
hsa-miR-103a-2-5p MIMAT0009196 AGCUUCUUUACAGUGCUGCCUUG A12P-miR-016
hsa-miR-106a-5p MIMAT0000103 AAAAGUGCUUACAGUGCAGGUAG A12P-miR-017
hsa-miR-106b-5p MIMAT0000680 UAAAGUGCUGACAGUGCAGAU A12P-miR-018
hsa-miR-107 MIMAT0000104 AGCAGCAUUGUACAGGGCUAUCA A12P-miR-019
hsa-miR-10a-5p MIMAT0000253 UACCCUGUAGAUCCGAAUUUGUG A12P-miR-020
hsa-miR-10b-5p MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG A12P-miR-021
hsa-miR-1180 MIMAT0005825 UUUCCGGCUCGCGUGGGUGUGU A12P-miR-022
hsa-miR-122-5p MIMAT0000421 UGGAGUGUGACAAUGGUGUUUG A12P-miR-023
hsa-miR-1247-5p MIMAT0005899 ACCCGUCCCGUUCGUCCCCGGA A12P-miR-024
hsa-miR-125a-5p MIMAT0000443 UCCCUGAGACCCUUUAACCUGUGA A12P-miR-025
hsa-miR-125b-5p MIMAT0000423 UCCCUGAGACCCUAACUUGUGA A12P-miR-026
hsa-miR-126-3p MIMAT0000445 UCGUACCGUGAGUAAUAAUGCG A12P-miR-027
hsa-miR-1260b MIMAT0015041 AUCCCACCACUGCCACCAU A12P-miR-028
hsa-miR-127-3p MIMAT0000446 UCGGAUCCGUCUGAGCUUGGCU A12P-miR-029
hsa-miR-128 MIMAT0000424 UCACAGUGAACCGGUCUCUUU A12P-miR-030
hsa-miR-1286 MIMAT0005877 UGCAGGACCAAGAUGAGCCCU A12P-miR-031
hsa-miR-1287 MIMAT0005878 UGCUGGAUCAGUGGUUCGAGUC A12P-miR-032
hsa-miR-129-5p MIMAT0000242 CUUUUUGCGGUCUGGGCUUGC A12P-miR-033
hsa-miR-1307-3p MIMAT0005951 ACUCGGCGUGGCGUCGGUCGUG A12P-miR-034
hsa-miR-130a-3p MIMAT0000425 CAGUGCAAUGUUAAAAGGGCAU A12P-miR-035
hsa-miR-130b-3p MIMAT0000691 CAGUGCAAUGAUGAAAGGGCAU A12P-miR-036
hsa-miR-132-3p MIMAT0000426 UAACAGUCUACAGCCAUGGUCG A12P-miR-037
hsa-miR-133a MIMAT0000427 UUUGGUCCCCUUCAACCAGCUG A12P-miR-038
hsa-miR-133b MIMAT0000770 UUUGGUCCCCUUCAACCAGCUA A12P-miR-039
hsa-miR-134 MIMAT0000447 UGUGACUGGUUGACCAGAGGGG A12P-miR-040
hsa-miR-136-5p MIMAT0000448 ACUCCAUUUGUUUUGAUGAUGGA A12P-miR-041
hsa-miR-137 MIMAT0000429 UUAUUGCUUAAGAAUACGCGUAG A12P-miR-042
hsa-miR-139-5p MIMAT0000250 UCUACAGUGCACGUGUCUCCAGU A12P-miR-043
hsa-miR-140-3p MIMAT0004597 UACCACAGGGUAGAACCACGG A12P-miR-044
hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG A12P-miR-045
hsa-miR-141-3p MIMAT0000432 UAACACUGUCUGGUAAAGAUGG A12P-miR-046
hsa-miR-142-3p MIMAT0000434 UGUAGUGUUUCCUACUUUAUGGA A12P-miR-047
hsa-miR-142-5p MIMAT0000433 CAUAAAGUAGAAAGCACUACU A12P-miR-048
hsa-miR-143-3p MIMAT0000435 UGAGAUGAAGCACUGUAGCUC A12P-miR-049
hsa-miR-144-3p MIMAT0000436 UACAGUAUAGAUGAUGUACU A12P-miR-050
hsa-miR-144-5p MIMAT0004600 GGAUAUCAUCAUAUACUGUAAG A12P-miR-051
hsa-miR-145-5p MIMAT0000437 GUCCAGUUUUCCCAGGAAUCCCU A12P-miR-052
hsa-miR-146a-5p MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU A12P-miR-053
hsa-miR-146b-5p MIMAT0002809 UGAGAACUGAAUUCCAUAGGCU A12P-miR-054
hsa-miR-147a MIMAT0000251 GUGUGUGGAAAUGCUUCUGC A12P-miR-055
hsa-miR-148a-3p MIMAT0000243 UCAGUGCACUACAGAACUUUGU A12P-miR-056
hsa-miR-148b-3p MIMAT0000759 UCAGUGCAUCACAGAACUUUGU A12P-miR-057
hsa-miR-149-5p MIMAT0000450 UCUGGCUCCGUGUCUUCACUCCC A12P-miR-058
hsa-miR-149-3p MIMAT0004609 AGGGAGGGACGGGGGCUGUGC A12P-miR-059
hsa-miR-150-5p MIMAT0000451 UCUCCCAACCCUUGUACCAGUG A12P-miR-060
hsa-miR-151a-3p MIMAT0000757 CUAGACUGAAGCUCCUUGAGG A12P-miR-061
hsa-miR-151a-5p MIMAT0004697 UCGAGGAGCUCACAGUCUAGU A12P-miR-062
hsa-miR-152 MIMAT0000438 UCAGUGCAUGACAGAACUUGG A12P-miR-063
hsa-miR-1539 MIMAT0007401 UCCUGCGCGUCCCAGAUGCCC A12P-miR-064
hsa-miR-155-5p MIMAT0000646 UUAAUGCUAAUCGUGAUAGGGGU A12P-miR-065
hsa-miR-15a-5p MIMAT0000068 UAGCAGCACAUAAUGGUUUGUG A12P-miR-066
hsa-miR-15b-5p MIMAT0000417 UAGCAGCACAUCAUGGUUUACA A12P-miR-067
hsa-miR-16-5p MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG A12P-miR-068
hsa-miR-16-2-3p MIMAT0004518 CCAAUAUUACUGUGCUGCUUUA A12P-miR-069
hsa-miR-17-5p MIMAT0000070 CAAAGUGCUUACAGUGCAGGUAG A12P-miR-070
hsa-miR-181a-5p MIMAT0000256 AACAUUCAACGCUGUCGGUGAGU A12P-miR-071
hsa-miR-181a-3p MIMAT0000270 ACCAUCGACCGUUGAUUGUACC A12P-miR-072
hsa-miR-181b-5p MIMAT0000257 AACAUUCAUUGCUGUCGGUGGGU A12P-miR-073
hsa-miR-181c-5p MIMAT0000258 AACAUUCAACCUGUCGGUGAGU A12P-miR-074
hsa-miR-182-5p MIMAT0000259 UUUGGCAAUGGUAGAACUCACACU A12P-miR-075
hsa-miR-183-5p MIMAT0000261 UAUGGCACUGGUAGAAUUCACU A12P-miR-076
hsa-miR-184 MIMAT0000454 UGGACGGAGAACUGAUAAGGGU A12P-miR-077
hsa-miR-185-5p MIMAT0000455 UGGAGAGAAAGGCAGUUCCUGA A12P-miR-078
hsa-miR-185-3p MIMAT0004611 AGGGGCUGGCUUUCCUCUGGUC A12P-miR-079
hsa-miR-186-5p MIMAT0000456 CAAAGAAUUCUCCUUUUGGGCU A12P-miR-080
hsa-miR-187-5p MIMAT0004561 GGCUACAACACAGGACCCGGGC A12P-miR-081
hsa-miR-188-5p MIMAT0000457 CAUCCCUUGCAUGGUGGAGGG A12P-miR-082
hsa-miR-18a-5p MIMAT0000072 UAAGGUGCAUCUAGUGCAGAUAG A12P-miR-083
hsa-miR-18a-3p MIMAT0002891 ACUGCCCUAAGUGCUCCUUCUGG A12P-miR-084
hsa-miR-18b-5p MIMAT0001412 UAAGGUGCAUCUAGUGCAGUUAG A12P-miR-085
hsa-miR-190a MIMAT0000458 UGAUAUGUUUGAUAUAUUAGGU A12P-miR-086
hsa-miR-191-5p MIMAT0000440 CAACGGAAUCCCAAAAGCAGCUG A12P-miR-087
hsa-miR-192-5p MIMAT0000222 CUGACCUAUGAAUUGACAGCC A12P-miR-088
hsa-miR-129-2-3p MIMAT0004605 AAGCCCUUACCCCAAAAAGCAU A12P-miR-089
hsa-miR-193b-3p MIMAT0002819 AACUGGCCCUCAAAGUCCCGCU A12P-miR-090
hsa-miR-194-5p MIMAT0000460 UGUAACAGCAACUCCAUGUGGA A12P-miR-091
hsa-miR-195-5p MIMAT0000461 UAGCAGCACAGAAAUAUUGGC A12P-miR-092
hsa-miR-196a-5p MIMAT0000226 UAGGUAGUUUCAUGUUGUUGGG A12P-miR-093
hsa-miR-196b-5p MIMAT0001080 UAGGUAGUUUCCUGUUGUUGGG A12P-miR-094
hsa-miR-197-3p MIMAT0000227 UUCACCACCUUCUCCACCCAGC A12P-miR-095
hsa-miR-1976 MIMAT0009451 CCUCCUGCCCUCCUUGCUGU A12P-miR-096
hsa-miR-199a-3p MIMAT0000232 ACAGUAGUCUGCACAUUGGUUA A12P-miR-097
hsa-miR-199a-5p MIMAT0000231 CCCAGUGUUCAGACUACCUGUUC A12P-miR-098
hsa-miR-19a-3p MIMAT0000073 UGUGCAAAUCUAUGCAAAACUGA A12P-miR-099
hsa-miR-19b-3p MIMAT0000074 UGUGCAAAUCCAUGCAAAACUGA A12P-miR-100
hsa-miR-200a-3p MIMAT0000682 UAACACUGUCUGGUAACGAUGU A12P-miR-101
hsa-miR-200b-3p MIMAT0000318 UAAUACUGCCUGGUAAUGAUGA A12P-miR-102
hsa-miR-202-3p MIMAT0002811 AGAGGUAUAGGGCAUGGGAA A12P-miR-103
hsa-miR-204-5p MIMAT0000265 UUCCCUUUGUCAUCCUAUGCCU A12P-miR-104
hsa-miR-205-5p MIMAT0000266 UCCUUCAUUCCACCGGAGUCUG A12P-miR-105
hsa-miR-208a MIMAT0000241 AUAAGACGAGCAAAAAGCUUGU A12P-miR-106
hsa-miR-20a-5p MIMAT0000075 UAAAGUGCUUAUAGUGCAGGUAG A12P-miR-107
hsa-miR-20a-3p MIMAT0004493 ACUGCAUUAUGAGCACUUAAAG A12P-miR-108
hsa-miR-20b-5p MIMAT0001413 CAAAGUGCUCAUAGUGCAGGUAG A12P-miR-109
hsa-miR-2110 MIMAT0010133 UUGGGGAAACGGCCGCUGAGUG A12P-miR-110
hsa-miR-212-3p MIMAT0000269 UAACAGUCUCCAGUCACGGCC A12P-miR-111
hsa-miR-215 MIMAT0000272 AUGACCUAUGAAUUGACAGAC A12P-miR-112
hsa-miR-216b MIMAT0004959 AAAUCUCUGCAGGCAAAUGUGA A12P-miR-113
hsa-miR-217 MIMAT0000274 UACUGCAUCAGGAACUGAUUGGA A12P-miR-114
hsa-miR-218-5p MIMAT0000275 UUGUGCUUGAUCUAACCAUGU A12P-miR-115
hsa-miR-22-5p MIMAT0004495 AGUUCUUCAGUGGCAAGCUUUA A12P-miR-116
hsa-miR-22-3p MIMAT0000077 AAGCUGCCAGUUGAAGAACUGU A12P-miR-117
hsa-miR-221-3p MIMAT0000278 AGCUACAUUGUCUGCUGGGUUUC A12P-miR-118
hsa-miR-222-3p MIMAT0000279 AGCUACAUCUGGCUACUGGGU A12P-miR-119
hsa-miR-223-3p MIMAT0000280 UGUCAGUUUGUCAAAUACCCCA A12P-miR-120
hsa-miR-223-5p MIMAT0004570 CGUGUAUUUGACAAGCUGAGUU A12P-miR-121
hsa-miR-224-5p MIMAT0000281 CAAGUCACUAGUGGUUCCGUU A12P-miR-122
hsa-miR-2355-3p MIMAT0017950 AUUGUCCUUGCUGUUUGGAGAU A12P-miR-123
hsa-miR-2355-5p MIMAT0016895 AUCCCCAGAUACAAUGGACAA A12P-miR-124
hsa-miR-23a-3p MIMAT0000078 AUCACAUUGCCAGGGAUUUCC A12P-miR-125
hsa-miR-23b-3p MIMAT0000418 AUCACAUUGCCAGGGAUUACC A12P-miR-126
hsa-miR-24-3p MIMAT0000080 UGGCUCAGUUCAGCAGGAACAG A12P-miR-127
hsa-miR-25-3p MIMAT0000081 CAUUGCACUUGUCUCGGUCUGA A12P-miR-128
hsa-miR-26a-5p MIMAT0000082 UUCAAGUAAUCCAGGAUAGGCU A12P-miR-129
hsa-miR-26b-5p MIMAT0000083 UUCAAGUAAUUCAGGAUAGGU A12P-miR-130
hsa-miR-27a-3p MIMAT0000084 UUCACAGUGGCUAAGUUCCGC A12P-miR-131
hsa-miR-27b-3p MIMAT0000419 UUCACAGUGGCUAAGUUCUGC A12P-miR-132
hsa-miR-28-3p MIMAT0004502 CACUAGAUUGUGAGCUCCUGGA A12P-miR-133
hsa-miR-28-5p MIMAT0000085 AAGGAGCUCACAGUCUAUUGAG A12P-miR-134
hsa-miR-297 MIMAT0004450 AUGUAUGUGUGCAUGUGCAUG A12P-miR-135
hsa-miR-299-3p MIMAT0000687 UAUGUGGGAUGGUAAACCGCUU A12P-miR-136
hsa-miR-29a-3p MIMAT0000086 UAGCACCAUCUGAAAUCGGUUA A12P-miR-137
hsa-miR-29a-5p MIMAT0004503 ACUGAUUUCUUUUGGUGUUCAG A12P-miR-138
hsa-miR-29b-3p MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU A12P-miR-139
hsa-miR-29b-2-5p MIMAT0004515 CUGGUUUCACAUGGUGGCUUAG A12P-miR-140
hsa-miR-29c-3p MIMAT0000681 UAGCACCAUUUGAAAUCGGUUA A12P-miR-141
hsa-miR-301b MIMAT0004958 CAGUGCAAUGAUAUUGUCAAAGC A12P-miR-142
hsa-miR-30a-5p MIMAT0000087 UGUAAACAUCCUCGACUGGAAG A12P-miR-143
hsa-miR-30b-5p MIMAT0000420 UGUAAACAUCCUACACUCAGCU A12P-miR-144
hsa-miR-30c-5p MIMAT0000244 UGUAAACAUCCUACACUCUCAGC A12P-miR-145
hsa-miR-30d-5p MIMAT0000245 UGUAAACAUCCCCGACUGGAAG A12P-miR-146
hsa-miR-30e-5p MIMAT0000692 UGUAAACAUCCUUGACUGGAAG A12P-miR-147
hsa-miR-30e-3p MIMAT0000693 CUUUCAGUCGGAUGUUUACAGC A12P-miR-148
hsa-miR-301a-3p MIMAT0000688 CAGUGCAAUAGUAUUGUCAAAGC A12P-miR-149
hsa-miR-302c-3p MIMAT0000717 UAAGUGCUUCCAUGUUUCAGUGG A12P-miR-150
hsa-miR-31-3p MIMAT0004504 UGCUAUGCCAACAUAUUGCCAU A12P-miR-151
hsa-miR-31-5p MIMAT0000089 AGGCAAGAUGCUGGCAUAGCU A12P-miR-152
hsa-miR-3176 MIMAT0015053 ACUGGCCUGGGACUACCGG A12P-miR-153
hsa-miR-3183 MIMAT0015063 GCCUCUCUCGGAGUCGCUCGGA A12P-miR-154
hsa-miR-32-5p MIMAT0000090 UAUUGCACAUUACUAAGUUGCA A12P-miR-155
hsa-miR-3200-5p MIMAT0017392 AAUCUGAGAAGGCGCACAAGGU A12P-miR-156
hsa-miR-320a MIMAT0000510 AAAAGCUGGGUUGAGAGGGCGA A12P-miR-157
hsa-miR-320b MIMAT0005792 AAAAGCUGGGUUGAGAGGGCAA A12P-miR-158
hsa-miR-323a-3p MIMAT0000755 CACAUUACACGGUCGACCUCU A12P-miR-159
hsa-miR-324-3p MIMAT0000762 ACUGCCCCAGGUGCUGCUGG A12P-miR-160
hsa-miR-324-5p MIMAT0000761 CGCAUCCCCUAGGGCAUUGGUGU A12P-miR-161
hsa-miR-326 MIMAT0000756 CCUCUGGGCCCUUCCUCCAG A12P-miR-162
hsa-miR-328 MIMAT0000752 CUGGCCCUCUCUGCCCUUCCGU A12P-miR-163
hsa-miR-331-3p MIMAT0000760 GCCCCUGGGCCUAUCCUAGAA A12P-miR-164
hsa-miR-335-5p MIMAT0000765 UCAAGAGCAAUAACGAAAAAUGU A12P-miR-165
hsa-miR-339-3p MIMAT0004702 UGAGCGCCUCGACGACAGAGCCG A12P-miR-166
hsa-miR-339-5p MIMAT0000764 UCCCUGUCCUCCAGGAGCUCACG A12P-miR-167
hsa-miR-33a-5p MIMAT0000091 GUGCAUUGUAGUUGCAUUGCA A12P-miR-168
hsa-miR-33b-5p MIMAT0003301 GUGCAUUGCUGUUGCAUUGC A12P-miR-169
hsa-miR-340-5p MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU A12P-miR-170
hsa-miR-342-3p MIMAT0000753 UCUCACACAGAAAUCGCACCCGU A12P-miR-171
hsa-miR-345-5p MIMAT0000772 GCUGACUCCUAGUCCAGGGCUC A12P-miR-172
hsa-miR-346 MIMAT0000773 UGUCUGCCCGCAUGCCUGCCUCU A12P-miR-173
hsa-miR-34c-3p MIMAT0004677 AAUCACUAACCACACGGCCAGG A12P-miR-174
hsa-miR-34c-5, p MIMAT0000686 AGGCAGUGUAGUUAGCUGAUUGC A12P-miR-175
hsa-miR-3613-3p MIMAT0017991 ACAAAAAAAAAAGCCCAACCCUUC A12P-miR-176
hsa-miR-361-3p MIMAT0004682 UCCCCCAGGUGUGAUUCUGAUUU A12P-miR-177
hsa-miR-363-3p MIMAT0000707 AAUUGCACGGUAUCCAUCUGUA A12P-miR-178
hsa-miR-365a-3p MIMAT0000710 UAAUGCCCCUAAAAAUCCUUAU A12P-miR-179
hsa-miR-3651 MIMAT0018071 CAUAGCCCGGUCGCUGGUACAUGA A12P-miR-180
hsa-miR-3689a-5p MIMAT0018117 UGUGAUAUCAUGGUUCCUGGGA A12P-miR-181
hsa-miR-369-5p MIMAT0001621 AGAUCGACCGUGUUAUAUUCGC A12P-miR-182
hsa-miR-372 MIMAT0000724 AAAGUGCUGCGACAUUUGAGCGU A12P-miR-183
hsa-miR-373-3p MIMAT0000726 GAAGUGCUUCGAUUUUGGGGUGU A12P-miR-184
hsa-miR-374a-5p MIMAT0000727 UUAUAAUACAACCUGAUAAGUG A12P-miR-185
hsa-miR-374b-5p MIMAT0004955 AUAUAAUACAACCUGCUAAGUG A12P-miR-186
hsa-miR-374b-3p MIMAT0004956 CUUAGCAGGUUGUAUUAUCAUU A12P-miR-187
hsa-miR-375 MIMAT0000728 UUUGUUCGUUCGGCUCGCGUGA A12P-miR-188
hsa-miR-376a-3p MIMAT0000729 AUCAUAGAGGAAAAUCCACGU A12P-miR-189
hsa-miR-376c-3p MIMAT0000720 AACAUAGAGGAAAUUCCACGU A12P-miR-190
hsa-miR-378a-3p MIMAT0000732 ACUGGACUUGGAGUCAGAAGG A12P-miR-191
hsa-miR-379-5p MIMAT0000733 UGGUAGACUAUGGAACGUAGG A12P-miR-192
hsa-miR-382-5p MIMAT0000737 GAAGUUGUUCGUGGUGGAUUCG A12P-miR-193
hsa-miR-383 MIMAT0000738 AGAUCAGAAGGUGAUUGUGGCU A12P-miR-194
hsa-miR-3907 MIMAT0018179 AGGUGCUCCAGGCUGGCUCACA A12P-miR-195
hsa-miR-409-3p MIMAT0001639 GAAUGUUGCUCGGUGAACCCCU A12P-miR-196
hsa-miR-421 MIMAT0003339 AUCAACAGACAUUAAUUGGGCGC A12P-miR-197
hsa-miR-422a MIMAT0001339 ACUGGACUUAGGGUCAGAAGGC A12P-miR-198
hsa-miR-423-3p MIMAT0001340 AGCUCGGUCUGAGGCCCCUCAGU A12P-miR-199
hsa-miR-423-5p MIMAT0004748 UGAGGGGCAGAGAGCGAGACUUU A12P-miR-200
hsa-miR-424-5p MIMAT0001341 CAGCAGCAAUUCAUGUUUUGAA A12P-miR-201
hsa-miR-425-5p MIMAT0003393 AAUGACACGAUCACUCCCGUUGA A12P-miR-202
hsa-miR-425-3p MIMAT0001343 AUCGGGAAUGUCGUGUCCGCCC A12P-miR-203
hsa-miR-4267 MIMAT0016893 UCCAGCUCGGUGGCAC A12P-miR-204
hsa-miR-429 MIMAT0001536 UAAUACUGUCUGGUAAAACCGU A12P-miR-205
hsa-miR-4454 MIMAT0018976 GGAUCCGAGUCACGGCACCA A12P-miR-206
hsa-miR-4505 MIMAT0019041 AGGCUGGGCUGGGACGGA A12P-miR-207
hsa-miR-451a MIMAT0001631 AAACCGUUACCAUUACUGAGUU A12P-miR-208
hsa-miR-4687-5p MIMAT0019774 CAGCCCUCCUCCCGCACCCAAA A12P-miR-209
hsa-miR-4689 MIMAT0019778 UUGAGGAGACAUGGUGGGGGCC A12P-miR-210
hsa-miR-484 MIMAT0002174 UCAGGCUCAGUCCCCUCCCGAU A12P-miR-211
hsa-miR-486-5p MIMAT0002177 UCCUGUACUGAGCUGCCCCGAG A12P-miR-212
hsa-miR-487b MIMAT0003180 AAUCGUACAGGGUCAUCCACUU A12P-miR-213
hsa-miR-491-5p MIMAT0002807 AGUGGGGAACCCUUCCAUGAGG A12P-miR-214
hsa-miR-492 MIMAT0002812 AGGACCUGCGGGACAAGAUUCUU A12P-miR-215
hsa-miR-495-3p MIMAT0002817 AAACAAACAUGGUGCACUUCUU A12P-miR-216
hsa-miR-497-5p MIMAT0002820 CAGCAGCACACUGUGGUUUGU A12P-miR-217
hsa-miR-499a-5p MIMAT0002870 UUAAGACUUGCAGUGAUGUUU A12P-miR-218
hsa-miR-500a-5p MIMAT0004773 UAAUCCUUGCUACCUGGGUGAGA A12P-miR-219
hsa-miR-501-3p MIMAT0004774 AAUGCACCCGGGCAAGGAUUCU A12P-miR-220
hsa-miR-501-5p MIMAT0002872 AAUCCUUUGUCCCUGGGUGAGA A12P-miR-221
hsa-miR-502-3p MIMAT0004775 AAUGCACCUGGGCAAGGAUUCA A12P-miR-222
hsa-miR-502-5p MIMAT0002873 AUCCUUGCUAUCUGGGUGCUA A12P-miR-223
hsa-miR-505-3p MIMAT0002876 CGUCAACACUUGCUGGUUUCCU A12P-miR-224
hsa-miR-509-3p MIMAT0002881 UGAUUGGUACGUCUGUGGGUAG A12P-miR-225
hsa-miR-516a-5p MIMAT0004770 UUCUCGAGGAAAGAAGCACUUUC A12P-miR-226
hsa-miR-517a-3p MIMAT0002852 AUCGUGCAUCCCUUUAGAGUGU A12P-miR-227
hsa-miR-518a-3p MIMAT0002863 GAAAGCGCUUCCCUUUGCUGGA A12P-miR-228
hsa-miR-518b MIMAT0002844 CAAAGCGCUCCCCUUUAGAGGU A12P-miR-229
hsa-miR-518c-3p MIMAT0002848 CAAAGCGCUUCUCUUUAGAGUGU A12P-miR-230
hsa-miR-518c-5p MIMAT0002847 UCUCUGGAGGGAAGCACUUUCUG A12P-miR-231
hsa-miR-518e-3p MIMAT0002861 AAAGCGCUUCCCUUCAGAGUG A12P-miR-232
hsa-miR-518f-3p MIMAT0002842 GAAAGCGCUUCUCUUUAGAGG A12P-miR-233
hsa-miR-519a-3p MIMAT0002869 AAAGUGCAUCCUUUUAGAGUGU A12P-miR-234
hsa-miR-519d MIMAT0002853 CAAAGUGCCUCCCUUUAGAGUG A12P-miR-235
hsa-miR-524-5p MIMAT0002849 CUACAAAGGGAAGCACUUUCUC A12P-miR-236
hsa-miR-532-3p MIMAT0004780 CCUCCCACACCCAAGGCUUGCA A12P-miR-237
hsa-miR-532-5p MIMAT0002888 CAUGCCUUGAGUGUAGGACCGU A12P-miR-238
hsa-miR-539-5p MIMAT0003163 GGAGAAAUUAUCCUUGGUGUGU A12P-miR-239
hsa-miR-543 MIMAT0004954 AAACAUUCGCGGUGCACUUCUU A12P-miR-240
hsa-miR-545-3p MIMAT0003165 UCAGCAAACAUUUAUUGUGUGC A12P-miR-241
hsa-miR-550a-5p MIMAT0004800 AGUGCCUGAGGGAGUAAGAGCCC A12P-miR-242
hsa-miR-551b-3p MIMAT0003233 GCGACCCAUACUUGGUUUCAG A12P-miR-243
hsa-miR-570-3p MIMAT0003235 CGAAAACAGCAAUUACCUUUGC A12P-miR-244
hsa-miR-574-3p MIMAT0003239 CACGCUCAUGCACACACCCACA A12P-miR-245
hsa-miR-584-5p MIMAT0003249 UUAUGGUUUGCCUGGGACUGAG A12P-miR-246
hsa-miR-589-5p MIMAT0004799 UGAGAACCACGUCUGCUCUGAG A12P-miR-247
hsa-miR-590-5p MIMAT0003258 GAGCUUAUUCAUAAAAGUGCAG A12P-miR-248
hsa-miR-596 MIMAT0003264 AAGCCUGCCCGGCUCCUCGGG A12P-miR-249
hsa-miR-617 MIMAT0003286 AGACUUCCCAUUUGAAGGUGGC A12P-miR-250
hsa-miR-629-5p MIMAT0004810 UGGGUUUACGUUGGGAGAACU A12P-miR-251
hsa-miR-652-3p MIMAT0003322 AAUGGCGCCACUAGGGUUGUG A12P-miR-252
hsa-miR-654-5p MIMAT0003330 UGGUGGGCCGCAGAACAUGUGC A12P-miR-253
hsa-miR-658 MIMAT0003336 GGCGGAGGGAAGUAGGUCCGUUGGU A12P-miR-254
hsa-miR-660-5p MIMAT0003338 UACCCAUUGCAUAUCGGAGUUG A12P-miR-255
hsa-miR-665 MIMAT0004952 ACCAGGAGGCUGAGGCCCCU A12P-miR-256
hsa-miR-668 MIMAT0003881 UGUCACUCGGCUCGGCCCACUAC A12P-miR-257
hsa-miR-7-5p MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGU A12P-miR-258
hsa-miR-744-5p MIMAT0004945 UGCGGGGCUAGGGCUAACAGCA A12P-miR-259
hsa-miR-873-5p MIMAT0004953 GCAGGAACUUGUGAGUCUCCU A12P-miR-260
hsa-miR-877-5p MIMAT0004949 GUAGAGGAGAUGGCGCAGGG A12P-miR-261
hsa-miR-885-5p MIMAT0004947 UCCAUUACACUACCCUGCCUCU A12P-miR-262
hsa-miR-890 MIMAT0004912 UACUUGGAAAGGCAUCAGUUG A12P-miR-263
hsa-miR-9-5p MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA A12P-miR-264
hsa-miR-9-3p MIMAT0000442 AUAAAGCUAGAUAACCGAAAGU A12P-miR-265
hsa-miR-921 MIMAT0004971 CUAGUGAGGGACAGAACCAGGAUUC A12P-miR-266
hsa-miR-92a-3p MIMAT0000092 UAUUGCACUUGUCCCGGCCUGU A12P-miR-267
hsa-miR-92b-3p MIMAT0003218 UAUUGCACUCGUCCCGGCCUCC A12P-miR-268
hsa-miR-93-5p MIMAT0000093 CAAAGUGCUGUUCGUGCAGGUAG A12P-miR-269
hsa-miR-93-3p MIMAT0004509 ACUGCUGAGCUAGCACUUCCCG A12P-miR-270
hsa-miR-933 MIMAT0004976 UGUGCGCAGGGAGACCUCUCCC A12P-miR-271
hsa-miR-940 MIMAT0004983 AAGGCAGGGCCCCCGCUCCCC A12P-miR-272
hsa-miR-96-3p MIMAT0004510 AAUCAUGUGCAGUGCCAAUAUG A12P-miR-273
hsa-miR-96-5p MIMAT0000095 UUUGGCACUAGCACAUUUUUGCU A12P-miR-274
hsa-miR-98-5p MIMAT0000096 UGAGGUAGUAAGUUGUAUUGUU A12P-miR-275
hsa-miR-99a-5p MIMAT0000097 AACCCGUAGAUCCGAUCUUGUG A12P-miR-276
hsa-miR-99a-3p MIMAT0004511 CAAGCUCGCUUCUAUGGGUCUG A12P-miR-277
hsa-miR-99b-5p MIMAT0000689 CACCCGUAGAACCGACCUUGCG A12P-miR-278