• Description
  • Highlights
  • Primer List
  • Manuals
Product NameCatalog NoSizePrice
miRStar™ Pre-designed miRNA-specific Forward Primers AS-MR-007 1 OD $68.00
Add To Cart

miRStar™ Pre-designed miRNA-specific Forward Primers are part of the miRStar™ miRNA PCR System, and can be used in combination with rtStar™ First-Strand cDNA Synthesis Kit (3’adaptor)(AS-FS-002) for mature miRNA detection and quantification. They cover 278 human mature miRNAs characterized in the latest miRBase version. All the primers have been validated in serum samples, and guarantee the most accurate and specific performance when used with miRStar™ SYBR® Green qPCR Master Mix (Figure 1).


Fig1.  Amplification curve (A) and Dissociation curve (B) of example miRNA has-miR-142-3p

Reliable results with validated primers

High sensitivity and specificity

Accurate quantification over a wide linear range

Time and cost savings with validated primers and SYBR Green assay

miR name Accession microRNA Target Sequence Catalog Number
hsa-let-7a-5p  MIMAT0000062 UGAGGUAGUAGGUUGUAUAGUU AS-MR-007-H001
hsa-let-7b-5p  MIMAT0000063 UGAGGUAGUAGGUUGUGUGGUU AS-MR-007-H002
hsa-let-7b-3p MIMAT0004482 CUAUACAACCUACUGCCUUCCC AS-MR-007-H003
hsa-let-7c MIMAT0000064 UGAGGUAGUAGGUUGUAUGGUU AS-MR-007-H004
hsa-let-7d-5p  MIMAT0000065 AGAGGUAGUAGGUUGCAUAGUU AS-MR-007-H005
hsa-let-7d-3p  MIMAT0004484 CUAUACGACCUGCUGCCUUUCU AS-MR-007-H006
hsa-let-7e-5p MIMAT0000066 UGAGGUAGGAGGUUGUAUAGUU AS-MR-007-H007
hsa-let-7f-5p  MIMAT0000067 UGAGGUAGUAGAUUGUAUAGUU AS-MR-007-H008
hsa-let-7g-5p  MIMAT0000414 UGAGGUAGUAGUUUGUACAGUU AS-MR-007-H009
hsa-let-7i-5p  MIMAT0000415 UGAGGUAGUAGUUUGUGCUGUU AS-MR-007-H010
hsa-let-7i-3p MIMAT0004585 CUGCGCAAGCUACUGCCUUGCU AS-MR-007-H011
hsa-miR-1 MIMAT0000416 UGGAAUGUAAAGAAGUAUGUAU AS-MR-007-H012
hsa-miR-100-5p MIMAT0000098 AACCCGUAGAUCCGAACUUGUG AS-MR-007-H013
hsa-miR-101-3p MIMAT0000099 UACAGUACUGUGAUAACUGAA AS-MR-007-H014
hsa-miR-103a-3p MIMAT0000101 AGCAGCAUUGUACAGGGCUAUGA AS-MR-007-H015
hsa-miR-103a-2-5p MIMAT0009196 AGCUUCUUUACAGUGCUGCCUUG AS-MR-007-H016
hsa-miR-106a-5p  MIMAT0000103 AAAAGUGCUUACAGUGCAGGUAG AS-MR-007-H017
hsa-miR-106b-5p  MIMAT0000680 UAAAGUGCUGACAGUGCAGAU AS-MR-007-H018
hsa-miR-107 MIMAT0000104 AGCAGCAUUGUACAGGGCUAUCA AS-MR-007-H019
hsa-miR-10a-5p MIMAT0000253 UACCCUGUAGAUCCGAAUUUGUG AS-MR-007-H020
hsa-miR-10b-5p MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG AS-MR-007-H021
hsa-miR-1180 MIMAT0005825 UUUCCGGCUCGCGUGGGUGUGU AS-MR-007-H022
hsa-miR-122-5p  MIMAT0000421 UGGAGUGUGACAAUGGUGUUUG AS-MR-007-H023
hsa-miR-1247-5p MIMAT0005899 ACCCGUCCCGUUCGUCCCCGGA AS-MR-007-H024
hsa-miR-125a-5p MIMAT0000443 UCCCUGAGACCCUUUAACCUGUGA AS-MR-007-H025
hsa-miR-125b-5p MIMAT0000423 UCCCUGAGACCCUAACUUGUGA AS-MR-007-H026
hsa-miR-126-3p  MIMAT0000445 UCGUACCGUGAGUAAUAAUGCG AS-MR-007-H027
hsa-miR-1260b MIMAT0015041 AUCCCACCACUGCCACCAU AS-MR-007-H028
hsa-miR-127-3p MIMAT0000446 UCGGAUCCGUCUGAGCUUGGCU AS-MR-007-H029
hsa-miR-128 MIMAT0000424 UCACAGUGAACCGGUCUCUUU AS-MR-007-H030
hsa-miR-1286 MIMAT0005877 UGCAGGACCAAGAUGAGCCCU AS-MR-007-H031
hsa-miR-1287 MIMAT0005878 UGCUGGAUCAGUGGUUCGAGUC AS-MR-007-H032
hsa-miR-129-5p MIMAT0000242 CUUUUUGCGGUCUGGGCUUGC AS-MR-007-H033
hsa-miR-1307-3p MIMAT0005951 ACUCGGCGUGGCGUCGGUCGUG AS-MR-007-H034
hsa-miR-130a-3p MIMAT0000425 CAGUGCAAUGUUAAAAGGGCAU AS-MR-007-H035
hsa-miR-130b-3p MIMAT0000691 CAGUGCAAUGAUGAAAGGGCAU AS-MR-007-H036
hsa-miR-132-3p MIMAT0000426 UAACAGUCUACAGCCAUGGUCG AS-MR-007-H037
hsa-miR-133a MIMAT0000427 UUUGGUCCCCUUCAACCAGCUG AS-MR-007-H038
hsa-miR-133b MIMAT0000770 UUUGGUCCCCUUCAACCAGCUA AS-MR-007-H039
hsa-miR-134 MIMAT0000447 UGUGACUGGUUGACCAGAGGGG AS-MR-007-H040
hsa-miR-136-5p MIMAT0000448 ACUCCAUUUGUUUUGAUGAUGGA AS-MR-007-H041
hsa-miR-137 MIMAT0000429 UUAUUGCUUAAGAAUACGCGUAG AS-MR-007-H042
hsa-miR-139-5p MIMAT0000250 UCUACAGUGCACGUGUCUCCAGU AS-MR-007-H043
hsa-miR-140-3p MIMAT0004597 UACCACAGGGUAGAACCACGG AS-MR-007-H044
hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG AS-MR-007-H045
hsa-miR-141-3p MIMAT0000432 UAACACUGUCUGGUAAAGAUGG AS-MR-007-H046
hsa-miR-142-3p MIMAT0000434 UGUAGUGUUUCCUACUUUAUGGA AS-MR-007-H047
hsa-miR-142-5p MIMAT0000433 CAUAAAGUAGAAAGCACUACU AS-MR-007-H048
hsa-miR-143-3p  MIMAT0000435 UGAGAUGAAGCACUGUAGCUC AS-MR-007-H049
hsa-miR-144-3p MIMAT0000436 UACAGUAUAGAUGAUGUACU AS-MR-007-H050
hsa-miR-144-5p MIMAT0004600 GGAUAUCAUCAUAUACUGUAAG AS-MR-007-H051
hsa-miR-145-5p  MIMAT0000437 GUCCAGUUUUCCCAGGAAUCCCU AS-MR-007-H052
hsa-miR-146a-5p MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU AS-MR-007-H053
hsa-miR-146b-5p MIMAT0002809 UGAGAACUGAAUUCCAUAGGCU AS-MR-007-H054
hsa-miR-147a MIMAT0000251 GUGUGUGGAAAUGCUUCUGC AS-MR-007-H055
hsa-miR-148a-3p MIMAT0000243 UCAGUGCACUACAGAACUUUGU AS-MR-007-H056
hsa-miR-148b-3p  MIMAT0000759 UCAGUGCAUCACAGAACUUUGU AS-MR-007-H057
hsa-miR-149-5p  MIMAT0000450 UCUGGCUCCGUGUCUUCACUCCC AS-MR-007-H058
hsa-miR-149-3p MIMAT0004609 AGGGAGGGACGGGGGCUGUGC AS-MR-007-H059
hsa-miR-150-5p MIMAT0000451 UCUCCCAACCCUUGUACCAGUG AS-MR-007-H060
hsa-miR-151a-3p MIMAT0000757 CUAGACUGAAGCUCCUUGAGG AS-MR-007-H061
hsa-miR-151a-5p MIMAT0004697 UCGAGGAGCUCACAGUCUAGU AS-MR-007-H062
hsa-miR-152 MIMAT0000438 UCAGUGCAUGACAGAACUUGG AS-MR-007-H063
hsa-miR-1539 MIMAT0007401 UCCUGCGCGUCCCAGAUGCCC AS-MR-007-H064
hsa-miR-155-5p MIMAT0000646 UUAAUGCUAAUCGUGAUAGGGGU AS-MR-007-H065
hsa-miR-15a-5p  MIMAT0000068 UAGCAGCACAUAAUGGUUUGUG AS-MR-007-H066
hsa-miR-15b-5p  MIMAT0000417 UAGCAGCACAUCAUGGUUUACA AS-MR-007-H067
hsa-miR-16-5p MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG AS-MR-007-H068
hsa-miR-16-2-3p MIMAT0004518 CCAAUAUUACUGUGCUGCUUUA AS-MR-007-H069
hsa-miR-17-5p MIMAT0000070 CAAAGUGCUUACAGUGCAGGUAG AS-MR-007-H070
hsa-miR-181a-5p MIMAT0000256 AACAUUCAACGCUGUCGGUGAGU AS-MR-007-H071
hsa-miR-181a-3p MIMAT0000270 ACCAUCGACCGUUGAUUGUACC AS-MR-007-H072
hsa-miR-181b-5p  MIMAT0000257 AACAUUCAUUGCUGUCGGUGGGU AS-MR-007-H073
hsa-miR-181c-5p MIMAT0000258 AACAUUCAACCUGUCGGUGAGU AS-MR-007-H074
hsa-miR-182-5p  MIMAT0000259 UUUGGCAAUGGUAGAACUCACACU AS-MR-007-H075
hsa-miR-183-5p  MIMAT0000261 UAUGGCACUGGUAGAAUUCACU AS-MR-007-H076
hsa-miR-184 MIMAT0000454 UGGACGGAGAACUGAUAAGGGU AS-MR-007-H077
hsa-miR-185-5p  MIMAT0000455 UGGAGAGAAAGGCAGUUCCUGA AS-MR-007-H078
hsa-miR-185-3p  MIMAT0004611 AGGGGCUGGCUUUCCUCUGGUC AS-MR-007-H079
hsa-miR-186-5p  MIMAT0000456 CAAAGAAUUCUCCUUUUGGGCU AS-MR-007-H080
hsa-miR-187-5p MIMAT0004561 GGCUACAACACAGGACCCGGGC AS-MR-007-H081
hsa-miR-188-5p MIMAT0000457 CAUCCCUUGCAUGGUGGAGGG AS-MR-007-H082
hsa-miR-18a-5p MIMAT0000072 UAAGGUGCAUCUAGUGCAGAUAG AS-MR-007-H083
hsa-miR-18a-3p MIMAT0002891 ACUGCCCUAAGUGCUCCUUCUGG AS-MR-007-H084
hsa-miR-18b-5p MIMAT0001412 UAAGGUGCAUCUAGUGCAGUUAG AS-MR-007-H085
hsa-miR-190a MIMAT0000458 UGAUAUGUUUGAUAUAUUAGGU AS-MR-007-H086
hsa-miR-191-5p  MIMAT0000440 CAACGGAAUCCCAAAAGCAGCUG AS-MR-007-H087
hsa-miR-192-5p MIMAT0000222 CUGACCUAUGAAUUGACAGCC AS-MR-007-H088
hsa-miR-129-2-3p MIMAT0004605 AAGCCCUUACCCCAAAAAGCAU AS-MR-007-H089
hsa-miR-193b-3p  MIMAT0002819 AACUGGCCCUCAAAGUCCCGCU AS-MR-007-H090
hsa-miR-194-5p MIMAT0000460 UGUAACAGCAACUCCAUGUGGA AS-MR-007-H091
hsa-miR-195-5p MIMAT0000461 UAGCAGCACAGAAAUAUUGGC AS-MR-007-H092
hsa-miR-196a-5p MIMAT0000226 UAGGUAGUUUCAUGUUGUUGGG AS-MR-007-H093
hsa-miR-196b-5p MIMAT0001080 UAGGUAGUUUCCUGUUGUUGGG AS-MR-007-H094
hsa-miR-197-3p  MIMAT0000227 UUCACCACCUUCUCCACCCAGC AS-MR-007-H095
hsa-miR-1976 MIMAT0009451 CCUCCUGCCCUCCUUGCUGU AS-MR-007-H096
hsa-miR-199a-3p MIMAT0000232 ACAGUAGUCUGCACAUUGGUUA AS-MR-007-H097
hsa-miR-199a-5p MIMAT0000231 CCCAGUGUUCAGACUACCUGUUC AS-MR-007-H098
hsa-miR-19a-3p MIMAT0000073 UGUGCAAAUCUAUGCAAAACUGA AS-MR-007-H099
hsa-miR-19b-3p  MIMAT0000074 UGUGCAAAUCCAUGCAAAACUGA AS-MR-007-H100
hsa-miR-200a-3p  MIMAT0000682 UAACACUGUCUGGUAACGAUGU AS-MR-007-H101
hsa-miR-200b-3p  MIMAT0000318 UAAUACUGCCUGGUAAUGAUGA AS-MR-007-H102
hsa-miR-202-3p MIMAT0002811 AGAGGUAUAGGGCAUGGGAA AS-MR-007-H103
hsa-miR-204-5p MIMAT0000265 UUCCCUUUGUCAUCCUAUGCCU AS-MR-007-H104
hsa-miR-205-5p MIMAT0000266 UCCUUCAUUCCACCGGAGUCUG AS-MR-007-H105
hsa-miR-208a MIMAT0000241 AUAAGACGAGCAAAAAGCUUGU AS-MR-007-H106
hsa-miR-20a-5p  MIMAT0000075 UAAAGUGCUUAUAGUGCAGGUAG AS-MR-007-H107
hsa-miR-20a-3p MIMAT0004493 ACUGCAUUAUGAGCACUUAAAG AS-MR-007-H108
hsa-miR-20b-5p MIMAT0001413 CAAAGUGCUCAUAGUGCAGGUAG AS-MR-007-H109
hsa-miR-2110 MIMAT0010133 UUGGGGAAACGGCCGCUGAGUG AS-MR-007-H110
hsa-miR-212-3p  MIMAT0000269 UAACAGUCUCCAGUCACGGCC AS-MR-007-H111
hsa-miR-215 MIMAT0000272 AUGACCUAUGAAUUGACAGAC AS-MR-007-H112
hsa-miR-216b MIMAT0004959 AAAUCUCUGCAGGCAAAUGUGA AS-MR-007-H113
hsa-miR-217 MIMAT0000274 UACUGCAUCAGGAACUGAUUGGA AS-MR-007-H114
hsa-miR-218-5p MIMAT0000275 UUGUGCUUGAUCUAACCAUGU AS-MR-007-H115
hsa-miR-22-5p MIMAT0004495 AGUUCUUCAGUGGCAAGCUUUA AS-MR-007-H116
hsa-miR-22-3p MIMAT0000077 AAGCUGCCAGUUGAAGAACUGU AS-MR-007-H117
hsa-miR-221-3p  MIMAT0000278 AGCUACAUUGUCUGCUGGGUUUC AS-MR-007-H118
hsa-miR-222-3p  MIMAT0000279 AGCUACAUCUGGCUACUGGGU AS-MR-007-H119
hsa-miR-223-3p  MIMAT0000280 UGUCAGUUUGUCAAAUACCCCA AS-MR-007-H120
hsa-miR-223-5p  MIMAT0004570 CGUGUAUUUGACAAGCUGAGUU AS-MR-007-H121
hsa-miR-224-5p MIMAT0000281 CAAGUCACUAGUGGUUCCGUU AS-MR-007-H122
hsa-miR-2355-3p MIMAT0017950 AUUGUCCUUGCUGUUUGGAGAU AS-MR-007-H123
hsa-miR-2355-5p MIMAT0016895 AUCCCCAGAUACAAUGGACAA AS-MR-007-H124
hsa-miR-23a-3p MIMAT0000078 AUCACAUUGCCAGGGAUUUCC AS-MR-007-H125
hsa-miR-23b-3p  MIMAT0000418 AUCACAUUGCCAGGGAUUACC AS-MR-007-H126
hsa-miR-24-3p  MIMAT0000080 UGGCUCAGUUCAGCAGGAACAG AS-MR-007-H127
hsa-miR-25-3p MIMAT0000081 CAUUGCACUUGUCUCGGUCUGA AS-MR-007-H128
hsa-miR-26a-5p  MIMAT0000082 UUCAAGUAAUCCAGGAUAGGCU AS-MR-007-H129
hsa-miR-26b-5p  MIMAT0000083 UUCAAGUAAUUCAGGAUAGGU AS-MR-007-H130
hsa-miR-27a-3p  MIMAT0000084 UUCACAGUGGCUAAGUUCCGC AS-MR-007-H131
hsa-miR-27b-3p  MIMAT0000419 UUCACAGUGGCUAAGUUCUGC AS-MR-007-H132
hsa-miR-28-3p MIMAT0004502 CACUAGAUUGUGAGCUCCUGGA AS-MR-007-H133
hsa-miR-28-5p MIMAT0000085 AAGGAGCUCACAGUCUAUUGAG AS-MR-007-H134
hsa-miR-297 MIMAT0004450 AUGUAUGUGUGCAUGUGCAUG AS-MR-007-H135
hsa-miR-299-3p MIMAT0000687 UAUGUGGGAUGGUAAACCGCUU AS-MR-007-H136
hsa-miR-29a-3p MIMAT0000086 UAGCACCAUCUGAAAUCGGUUA AS-MR-007-H137
hsa-miR-29a-5p MIMAT0004503 ACUGAUUUCUUUUGGUGUUCAG AS-MR-007-H138
hsa-miR-29b-3p  MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU AS-MR-007-H139
hsa-miR-29b-2-5p MIMAT0004515 CUGGUUUCACAUGGUGGCUUAG AS-MR-007-H140
hsa-miR-29c-3p  MIMAT0000681 UAGCACCAUUUGAAAUCGGUUA AS-MR-007-H141
hsa-miR-301b MIMAT0004958 CAGUGCAAUGAUAUUGUCAAAGC AS-MR-007-H142
hsa-miR-30a-5p  MIMAT0000087 UGUAAACAUCCUCGACUGGAAG AS-MR-007-H143
hsa-miR-30b-5p MIMAT0000420 UGUAAACAUCCUACACUCAGCU AS-MR-007-H144
hsa-miR-30c-5p  MIMAT0000244 UGUAAACAUCCUACACUCUCAGC AS-MR-007-H145
hsa-miR-30d-5p  MIMAT0000245 UGUAAACAUCCCCGACUGGAAG AS-MR-007-H146
hsa-miR-30e-5p  MIMAT0000692 UGUAAACAUCCUUGACUGGAAG AS-MR-007-H147
hsa-miR-30e-3p  MIMAT0000693 CUUUCAGUCGGAUGUUUACAGC AS-MR-007-H148
hsa-miR-301a-3p MIMAT0000688 CAGUGCAAUAGUAUUGUCAAAGC AS-MR-007-H149
hsa-miR-302c-3p  MIMAT0000717 UAAGUGCUUCCAUGUUUCAGUGG AS-MR-007-H150
hsa-miR-31-3p  MIMAT0004504 UGCUAUGCCAACAUAUUGCCAU AS-MR-007-H151
hsa-miR-31-5p  MIMAT0000089 AGGCAAGAUGCUGGCAUAGCU AS-MR-007-H152
hsa-miR-3176 MIMAT0015053 ACUGGCCUGGGACUACCGG AS-MR-007-H153
hsa-miR-3183 MIMAT0015063 GCCUCUCUCGGAGUCGCUCGGA AS-MR-007-H154
hsa-miR-32-5p MIMAT0000090 UAUUGCACAUUACUAAGUUGCA AS-MR-007-H155
hsa-miR-3200-5p MIMAT0017392 AAUCUGAGAAGGCGCACAAGGU AS-MR-007-H156
hsa-miR-320a MIMAT0000510 AAAAGCUGGGUUGAGAGGGCGA AS-MR-007-H157
hsa-miR-320b MIMAT0005792 AAAAGCUGGGUUGAGAGGGCAA AS-MR-007-H158
hsa-miR-323a-3p MIMAT0000755 CACAUUACACGGUCGACCUCU AS-MR-007-H159
hsa-miR-324-3p MIMAT0000762 ACUGCCCCAGGUGCUGCUGG AS-MR-007-H160
hsa-miR-324-5p MIMAT0000761 CGCAUCCCCUAGGGCAUUGGUGU AS-MR-007-H161
hsa-miR-326 MIMAT0000756 CCUCUGGGCCCUUCCUCCAG AS-MR-007-H162
hsa-miR-328 MIMAT0000752 CUGGCCCUCUCUGCCCUUCCGU AS-MR-007-H163
hsa-miR-331-3p MIMAT0000760 GCCCCUGGGCCUAUCCUAGAA AS-MR-007-H164
hsa-miR-335-5p MIMAT0000765 UCAAGAGCAAUAACGAAAAAUGU AS-MR-007-H165
hsa-miR-339-3p MIMAT0004702 UGAGCGCCUCGACGACAGAGCCG AS-MR-007-H166
hsa-miR-339-5p MIMAT0000764 UCCCUGUCCUCCAGGAGCUCACG AS-MR-007-H167
hsa-miR-33a-5p  MIMAT0000091 GUGCAUUGUAGUUGCAUUGCA AS-MR-007-H168
hsa-miR-33b-5p  MIMAT0003301 GUGCAUUGCUGUUGCAUUGC AS-MR-007-H169
hsa-miR-340-5p  MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU AS-MR-007-H170
hsa-miR-342-3p MIMAT0000753 UCUCACACAGAAAUCGCACCCGU AS-MR-007-H171
hsa-miR-345-5p  MIMAT0000772 GCUGACUCCUAGUCCAGGGCUC AS-MR-007-H172
hsa-miR-346 MIMAT0000773 UGUCUGCCCGCAUGCCUGCCUCU AS-MR-007-H173
hsa-miR-34c-3p MIMAT0004677 AAUCACUAACCACACGGCCAGG AS-MR-007-H174
hsa-miR-34c-5p MIMAT0000686 AGGCAGUGUAGUUAGCUGAUUGC AS-MR-007-H175
hsa-miR-3613-3p MIMAT0017991 ACAAAAAAAAAAGCCCAACCCUUC AS-MR-007-H176
hsa-miR-361-3p MIMAT0004682 UCCCCCAGGUGUGAUUCUGAUUU AS-MR-007-H177
hsa-miR-363-3p MIMAT0000707 AAUUGCACGGUAUCCAUCUGUA AS-MR-007-H178
hsa-miR-365a-3p MIMAT0000710 UAAUGCCCCUAAAAAUCCUUAU AS-MR-007-H179
hsa-miR-3651 MIMAT0018071 CAUAGCCCGGUCGCUGGUACAUGA AS-MR-007-H180
hsa-miR-3689a-5p MIMAT0018117 UGUGAUAUCAUGGUUCCUGGGA AS-MR-007-H181
hsa-miR-369-5p MIMAT0001621 AGAUCGACCGUGUUAUAUUCGC AS-MR-007-H182
hsa-miR-372 MIMAT0000724 AAAGUGCUGCGACAUUUGAGCGU AS-MR-007-H183
hsa-miR-373-3p MIMAT0000726 GAAGUGCUUCGAUUUUGGGGUGU AS-MR-007-H184
hsa-miR-374a-5p  MIMAT0000727 UUAUAAUACAACCUGAUAAGUG AS-MR-007-H185
hsa-miR-374b-5p MIMAT0004955 AUAUAAUACAACCUGCUAAGUG AS-MR-007-H186
hsa-miR-374b-3p MIMAT0004956 CUUAGCAGGUUGUAUUAUCAUU AS-MR-007-H187
hsa-miR-375 MIMAT0000728 UUUGUUCGUUCGGCUCGCGUGA AS-MR-007-H188
hsa-miR-376a-3p MIMAT0000729 AUCAUAGAGGAAAAUCCACGU AS-MR-007-H189
hsa-miR-376c-3p MIMAT0000720 AACAUAGAGGAAAUUCCACGU AS-MR-007-H190
hsa-miR-378a-3p MIMAT0000732 ACUGGACUUGGAGUCAGAAGG AS-MR-007-H191
hsa-miR-379-5p  MIMAT0000733 UGGUAGACUAUGGAACGUAGG AS-MR-007-H192
hsa-miR-382-5p  MIMAT0000737 GAAGUUGUUCGUGGUGGAUUCG AS-MR-007-H193
hsa-miR-383 MIMAT0000738 AGAUCAGAAGGUGAUUGUGGCU AS-MR-007-H194
hsa-miR-3907 MIMAT0018179 AGGUGCUCCAGGCUGGCUCACA AS-MR-007-H195
hsa-miR-409-3p MIMAT0001639 GAAUGUUGCUCGGUGAACCCCU AS-MR-007-H196
hsa-miR-421 MIMAT0003339 AUCAACAGACAUUAAUUGGGCGC AS-MR-007-H197
hsa-miR-422a MIMAT0001339 ACUGGACUUAGGGUCAGAAGGC AS-MR-007-H198
hsa-miR-423-3p MIMAT0001340 AGCUCGGUCUGAGGCCCCUCAGU AS-MR-007-H199
hsa-miR-423-5p MIMAT0004748 UGAGGGGCAGAGAGCGAGACUUU AS-MR-007-H200
hsa-miR-424-5p MIMAT0001341 CAGCAGCAAUUCAUGUUUUGAA AS-MR-007-H201
hsa-miR-425-5p  MIMAT0003393 AAUGACACGAUCACUCCCGUUGA AS-MR-007-H202
hsa-miR-425-3p  MIMAT0001343 AUCGGGAAUGUCGUGUCCGCCC AS-MR-007-H203
hsa-miR-4267 MIMAT0016893 UCCAGCUCGGUGGCAC AS-MR-007-H204
hsa-miR-429 MIMAT0001536 UAAUACUGUCUGGUAAAACCGU AS-MR-007-H205
hsa-miR-4454 MIMAT0018976 GGAUCCGAGUCACGGCACCA AS-MR-007-H206
hsa-miR-4505 MIMAT0019041 AGGCUGGGCUGGGACGGA AS-MR-007-H207
hsa-miR-451a  MIMAT0001631 AAACCGUUACCAUUACUGAGUU AS-MR-007-H208
hsa-miR-4687-5p MIMAT0019774 CAGCCCUCCUCCCGCACCCAAA AS-MR-007-H209
hsa-miR-4689 MIMAT0019778 UUGAGGAGACAUGGUGGGGGCC AS-MR-007-H210
hsa-miR-484 MIMAT0002174 UCAGGCUCAGUCCCCUCCCGAU AS-MR-007-H211
hsa-miR-486-5p MIMAT0002177 UCCUGUACUGAGCUGCCCCGAG AS-MR-007-H212
hsa-miR-487b MIMAT0003180 AAUCGUACAGGGUCAUCCACUU AS-MR-007-H213
hsa-miR-491-5p MIMAT0002807 AGUGGGGAACCCUUCCAUGAGG AS-MR-007-H214
hsa-miR-492 MIMAT0002812 AGGACCUGCGGGACAAGAUUCUU AS-MR-007-H215
hsa-miR-495-3p  MIMAT0002817 AAACAAACAUGGUGCACUUCUU AS-MR-007-H216
hsa-miR-497-5p  MIMAT0002820 CAGCAGCACACUGUGGUUUGU AS-MR-007-H217
hsa-miR-499a-5p MIMAT0002870 UUAAGACUUGCAGUGAUGUUU AS-MR-007-H218
hsa-miR-500a-5p MIMAT0004773 UAAUCCUUGCUACCUGGGUGAGA AS-MR-007-H219
hsa-miR-501-3p MIMAT0004774 AAUGCACCCGGGCAAGGAUUCU AS-MR-007-H220
hsa-miR-501-5p MIMAT0002872 AAUCCUUUGUCCCUGGGUGAGA AS-MR-007-H221
hsa-miR-502-3p MIMAT0004775 AAUGCACCUGGGCAAGGAUUCA AS-MR-007-H222
hsa-miR-502-5p MIMAT0002873 AUCCUUGCUAUCUGGGUGCUA AS-MR-007-H223
hsa-miR-505-3p  MIMAT0002876 CGUCAACACUUGCUGGUUUCCU AS-MR-007-H224
hsa-miR-509-3p MIMAT0002881 UGAUUGGUACGUCUGUGGGUAG AS-MR-007-H225
hsa-miR-516a-5p MIMAT0004770 UUCUCGAGGAAAGAAGCACUUUC AS-MR-007-H226
hsa-miR-517a-3p  MIMAT0002852 AUCGUGCAUCCCUUUAGAGUGU AS-MR-007-H227
hsa-miR-518a-3p MIMAT0002863 GAAAGCGCUUCCCUUUGCUGGA AS-MR-007-H228
hsa-miR-518b MIMAT0002844 CAAAGCGCUCCCCUUUAGAGGU AS-MR-007-H229
hsa-miR-518c-3p  MIMAT0002848 CAAAGCGCUUCUCUUUAGAGUGU AS-MR-007-H230
hsa-miR-518c-5p  MIMAT0002847 UCUCUGGAGGGAAGCACUUUCUG AS-MR-007-H231
hsa-miR-518e-3p  MIMAT0002861 AAAGCGCUUCCCUUCAGAGUG AS-MR-007-H232
hsa-miR-518f-3p MIMAT0002842 GAAAGCGCUUCUCUUUAGAGG AS-MR-007-H233
hsa-miR-519a-3p MIMAT0002869 AAAGUGCAUCCUUUUAGAGUGU AS-MR-007-H234
hsa-miR-519d MIMAT0002853 CAAAGUGCCUCCCUUUAGAGUG AS-MR-007-H235
hsa-miR-524-5p MIMAT0002849 CUACAAAGGGAAGCACUUUCUC AS-MR-007-H236
hsa-miR-532-3p MIMAT0004780 CCUCCCACACCCAAGGCUUGCA AS-MR-007-H237
hsa-miR-532-5p MIMAT0002888 CAUGCCUUGAGUGUAGGACCGU AS-MR-007-H238
hsa-miR-539-5p  MIMAT0003163 GGAGAAAUUAUCCUUGGUGUGU AS-MR-007-H239
hsa-miR-543 MIMAT0004954 AAACAUUCGCGGUGCACUUCUU AS-MR-007-H240
hsa-miR-545-3p MIMAT0003165 UCAGCAAACAUUUAUUGUGUGC AS-MR-007-H241
hsa-miR-550a-5p MIMAT0004800 AGUGCCUGAGGGAGUAAGAGCCC AS-MR-007-H242
hsa-miR-551b-3p MIMAT0003233 GCGACCCAUACUUGGUUUCAG AS-MR-007-H243
hsa-miR-570-3p MIMAT0003235 CGAAAACAGCAAUUACCUUUGC AS-MR-007-H244
hsa-miR-574-3p MIMAT0003239 CACGCUCAUGCACACACCCACA AS-MR-007-H245
hsa-miR-584-5p  MIMAT0003249 UUAUGGUUUGCCUGGGACUGAG AS-MR-007-H246
hsa-miR-589-5p MIMAT0004799 UGAGAACCACGUCUGCUCUGAG AS-MR-007-H247
hsa-miR-590-5p MIMAT0003258 GAGCUUAUUCAUAAAAGUGCAG AS-MR-007-H248
hsa-miR-596 MIMAT0003264 AAGCCUGCCCGGCUCCUCGGG AS-MR-007-H249
hsa-miR-617 MIMAT0003286 AGACUUCCCAUUUGAAGGUGGC AS-MR-007-H250
hsa-miR-629-5p MIMAT0004810 UGGGUUUACGUUGGGAGAACU AS-MR-007-H251
hsa-miR-652-3p  MIMAT0003322 AAUGGCGCCACUAGGGUUGUG AS-MR-007-H252
hsa-miR-654-5p MIMAT0003330 UGGUGGGCCGCAGAACAUGUGC AS-MR-007-H253
hsa-miR-658 MIMAT0003336 GGCGGAGGGAAGUAGGUCCGUUGGU AS-MR-007-H254
hsa-miR-660-5p MIMAT0003338 UACCCAUUGCAUAUCGGAGUUG AS-MR-007-H255
hsa-miR-665 MIMAT0004952 ACCAGGAGGCUGAGGCCCCU AS-MR-007-H256
hsa-miR-668 MIMAT0003881 UGUCACUCGGCUCGGCCCACUAC AS-MR-007-H257
hsa-miR-7-5p MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGU AS-MR-007-H258
hsa-miR-744-5p MIMAT0004945 UGCGGGGCUAGGGCUAACAGCA AS-MR-007-H259
hsa-miR-873-5p  MIMAT0004953 GCAGGAACUUGUGAGUCUCCU AS-MR-007-H260
hsa-miR-877-5p MIMAT0004949 GUAGAGGAGAUGGCGCAGGG AS-MR-007-H261
hsa-miR-885-5p MIMAT0004947 UCCAUUACACUACCCUGCCUCU AS-MR-007-H262
hsa-miR-890 MIMAT0004912 UACUUGGAAAGGCAUCAGUUG AS-MR-007-H263
hsa-miR-9-5p  MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA AS-MR-007-H264
hsa-miR-9-3p MIMAT0000442 AUAAAGCUAGAUAACCGAAAGU AS-MR-007-H265
hsa-miR-921 MIMAT0004971 CUAGUGAGGGACAGAACCAGGAUUC AS-MR-007-H266
hsa-miR-92a-3p  MIMAT0000092 UAUUGCACUUGUCCCGGCCUGU AS-MR-007-H267
hsa-miR-92b-3p MIMAT0003218 UAUUGCACUCGUCCCGGCCUCC AS-MR-007-H268
hsa-miR-93-5p  MIMAT0000093 CAAAGUGCUGUUCGUGCAGGUAG AS-MR-007-H269
hsa-miR-93-3p MIMAT0004509 ACUGCUGAGCUAGCACUUCCCG AS-MR-007-H270
hsa-miR-933 MIMAT0004976 UGUGCGCAGGGAGACCUCUCCC AS-MR-007-H271
hsa-miR-940 MIMAT0004983 AAGGCAGGGCCCCCGCUCCCC AS-MR-007-H272
hsa-miR-96-3p MIMAT0004510 AAUCAUGUGCAGUGCCAAUAUG AS-MR-007-H273
hsa-miR-96-5p MIMAT0000095 UUUGGCACUAGCACAUUUUUGCU AS-MR-007-H274
hsa-miR-98-5p  MIMAT0000096 UGAGGUAGUAAGUUGUAUUGUU AS-MR-007-H275
hsa-miR-99a-5p  MIMAT0000097 AACCCGUAGAUCCGAUCUUGUG AS-MR-007-H276
hsa-miR-99a-3p  MIMAT0004511 CAAGCUCGCUUCUAUGGGUCUG AS-MR-007-H277
hsa-miR-99b-5p  MIMAT0000689 CACCCGUAGAACCGACCUUGCG AS-MR-007-H278

 

House Keeping Gene Catalog Number
hsa-miR-16-5p AS-MR-007-H279
hsa-miR-191-5p AS-MR-007-H280
hsa-miR-432-3p AS-MR-007-H281
hsa-miR-435-5p AS-MR-007-H282
hsa-miR-93-5p AS-MR-007-H283